Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BIO5
Systematic Name YNR056C
Strain S288c
Description Putative transmembrane protein involved in the biotin biosynthesis pathway; responsible for uptake of 7-keto 8-aminopelargonic acid; BIO5 is in a cluster of 3 genes (BIO3, BIO4, and BIO5) that mediate biotin synthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>BIO5 YNR056C
ATGAACAGAGTAGGGGCAGTGTTCCTATTTGTATATGAAAGAAATTTTTTTTTGTCTATT
GTTCCAGATCGTCACAGGACGGAAATAAGAATGTCTAGTTCAGAAAGGTCAGAAGTCAAG
TTTGACAAGCACTTTAATTGGTGGTCCCTATTAGGTATCGCGTTCTCATTAAGTTGCTCA
TGGGTCGGTATCTCAGCGTCGATGGCCGTTGGTATTGCCAGTGGAGGGCCACTGCTTATC
ATCTATGGGTTGATAATTGCTGCTTTTTTCAGTCTCATGTGTGGTATATCTCTGGGAGAT
TTTGCTGCTATCCTGCCAAACAGCAGCGGTGGTTCATTTTGGGTTCTTAAAATGTTGGAA
CAAGAATCAGTCACTTTGAAAACCCCTGAGTACGAGGACCCTTCTGACGATGATGAAGAA
GTGTTCCTCGAGAATTATTGTCAAACTTTCAACGTGGAAGTTTCTTCTAAATTTCAAAAG
GTTTCTTCCATGGTTGTAGGGTTGCTGAACTATTTCGGTGCCATTTTTACTACCGCAAGT
ATCTGCTCATCTTTGTCAATGAGCTGTATCGGTATTCATAAGTTGTTGCATCCGGACTAC
GAGTTAAAGCACTGGCATGTTTTTGTGGGTTACGAGTGTATCAATGCCGTTTTGACACTT
TTCAACATTTATTCAACTCCGTTGCCCTATATCTCTCAGTTTGGGCTCTATACGTCTCTA
TTGTCTTTCGCCATGACTTTCATTATTTGTATTGTTTCAAGATCTGACAACACCGTAGAC
CCATGGCCCAAAGCTTCTAATATATTTGGGAGCTTTGATAATCAAACAGGCTGGAATTCG
TCTGGAATGGCGTTTGTTGTCGGTTTGGTCAATCCGATCTGGGCATTTGTTGGCATTGAC
TCTGCTACGCACATGATTGATGAAGTGGGTTATAGTAAGTCACGTTTCTTAGTTCCCAAA
GTTATTATCACTACCATCATTGTGGGCTTTGTAACTAGTTTTATTTATTGCGTTGGTTTG
TTTTTCTGCATCACTGACCAAACGGCAGTCGTTGAGTCTATTTTACCTATCGTAGAAATA
TTTTACCAGGCCACTGGTAATAGGAATCTCAGTGTCTTCCTGCAATGTATGTGTATCACA
ACAGGTTTTGTTTCAGGCATTGCAAGTGGAACCTGGCAAAGTCGAATCCTCCAATCATTC
GGGAAAAGTTACGCACCATTTTATAAAGAGGGTTCCTTGGGAAACAAATCCTTGAAGAAG
CTAGCAGTGTTGACACCTGGGTTTAAGTCTCCATTATATGCCCATTTTTTGTCACAAATA
TGTGTAACGATAATTGGCTGTATATTTATGGGATCTAGTACCGCTTTCAACGCAATTATC
ACTGCATGCATCACCCTGTTACTAATGTCGTACGCAGTTCCTTCTTTTATATTCCTGTTC
GTTATTAAAAAGGAAAAATTCATTCATAGAATCGAGAGTGACGTAAATTGTGTCAGCAGG
CCTAACCGTCGTCGTATGTCTATGATTCCTCATATTATATGTATTCTATGGACCTTGTTC
TGCCTGGTATTTTTATCTTTCCCATATACACTACCGGTTACTGCAGGAAACATGAATTAC
ACCTCAGTAGTGTATGCAGTAGTTTTCTGCATTATCAGCATCGTTGTTTTCCCTACATGC
ATCTAA
Promoter Sequence
Download FASTA
>BIO5 YNR056C
TTTCTTGGGACATTAGTTGTTATCCTAGCAATAGAAAACGAATTGCGCTGTTGACATCCT
CCCGACCAAAAGAAAATGAAATATACAAACAATGGCTATTTATAATTCAAAATTATTGGG
CAAAACAAAATAAAATCCCGCTGGTAGTTCGTTTACTGAAGTATATAAAGAGATATACTT
TTTTCCACAAGTAGGCCAGTGAAAAGAACTCAAAAAATCACTAGCGCACAGGTCATGAAC
AGCAAATCTCAACAACAAGAACAACAACCAATTGTATTCGTCACCGGTACAGACACTGAT
GTTGGTAAAACCTTTGTATCAACATTATTGGTACACAAATGGAAAGCTGCATACTGGAAA
CCCGTACAAACTGGAATTGAGTCAGATCAAGGTGACTCCGAGACATTGAAAAATTTCAAA
ATAGCCGCATCAACTTGGCAACCACCTATATTCACGCCCACTTATGCGCTGCAGAAGCCT
CTATCTCCGCTCCAGGCCATGGAGTACGAACCTAATGTCGACATCAGGTTGTTGGATTTC
GTAGTTCCTGAAGAGTGGAGCGCAGAGAATCCATTGGTCGTAGAAGGAGCCGGCGGGGTT
TGCGTTCCTATCACTCGTAAATTGGAAATTACGACGGATCTAATTAAACATCTGATTGAG
ACTAGCGGCCATCCAGTGTACGTAGTTGTCGTGGCACGCAGCGGGCTAGGGACTCTGAAT
CATACATTGCTGACTTGGAATCATCTTTGCGATAATGGCTTGAGAAGCCACCTTTTTGGG
GTCATTCTCAATGGGGAACCGAATGAAGGCAACGTGCAGGCCCTGAAGAAGTTCGGTGTC
AATATTATGGCACAGGTTGCACAATGTACTACGGCACATGATCAGGATATGGAGTTGCAT
GAACTGCCATCGGTGGAGTCATTAATGACCCAACAAGACGTAGAATAGTTTAAATAAAAA
AGTTGCAAGGCTTTCATCAGCTATATATAAGTAGCATGGT
Chr coordinates Chr XIV from 733303-731618
w3c xhtml validator w3c css validator