Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNR061C
Systematic Name YNR061C
Strain S288c
Description Protein of unknown function; relocalizes from vacuole to cytoplasm upon DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNR061C YNR061C
CAAGGTCCAGTTGATGCCTTCAATTGGAGCAATCTCTGGGATTGGTAAACTGGTGGCACC
GATTGTATTAGCAGCTCTTTATGGCACAAGATTGGGGCTTTCAATTGCGGTTGGATTTGG
TATGATTTTGGTAGCTGTTTCAATTCCACCGCTTATTTGGCTCAGGAAAAAAAGGTGTTA
GATTTCCTTAGACATATACTGGTCCAAATCCAGCTATATATCGGGTGCCATTGACGTATA
TTTTTTCGAAGAACTTGGACGACAAAAAGTCAGCCTCTTTTTTATGGCGTTCTATCAACA
AATTTTACATTTGGAAATGATAGTGTATTATCTTTACCATTTCTATAGTGATATATCCGG
ACTAATCTTTTAGCGGCCATAAATAAATATTACTAATATTTAAAGTTTCCTTCTGATTTA
TTCTTCTATTATATTCAAACCAGTTGTGGAAAAGTGTGTGCCTCTTTTATATGGCACTTT
ATACTGAATGATGTAATCAGTTTGCATGGACGCCAAAGCTTGTATTTTAACCAAGGTTTT
TTAGAGTTTGGCCGCTTCAAAGTTAAAGACGTTAGGCAATTCGCATAACCTTTTCTTTAA
TCTCAATATATTATTCTAATCTTATTCTGCAAATTGTCATTGGAATTCGCTTCCGATTTG
CTGTACTGCTTGCTGAATAATATCTGCTCTTGCATTGGCAGGTGAGAAATGAATACTATC
TTTTAAGGATGTTGGTTTATAATCTCTCGGAGACTAAAAACCAACTTCTCAAAATGATTT
ATGTATTTGCCCAAAGTTAAAATTGCGTGTTTCCAATTACGTATGCGATATGTAAAAAAA
TTAAAAAAGTGAATGAATAAGCGACTTTTCGAGTTGCTATTTTTTTCTTGGTTCAACAGA
AGTAAAATATAATCAACCATAAATAGGAGAATACAGGCGGTGCTTACAGCTTGATATTTT
GTTACCAAGTCAAGATCTATAATAATAACTCAATACATAT
Chr coordinates Chr XIV from 743540-742881
w3c xhtml validator w3c css validator