Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PUL4
Systematic Name YNR063W
Strain S288c
Description Putative zinc-cluster protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PUL4 YNR063W
CAGATTAGGAAATTTTGTTCCGCTTAGAATGGGATAGGCTTGTTTGGGCGCTATACTTCT
GTATCAAAATAGTAAAATCAACTTATTTTAGTAATAGAAGAGAACAGTAGGCGTTTGGTA
ATTCTAATTACCTAGACTGTCCCCCATTTCCAGACAGCTGTCCCATATTTTTTTGAGATT
CCGACGTCGAAGCGAAAGACTAGAAGAATAAGTAAAGTGGTCCTTTGTAAGCATAAAGAC
AAAGGCATGTGAGAAAAGTAAGTGTCTTCGCGATTCGCCGTTGTAAATATGTATCAGCTT
TTTTTACTGCCTTTTCCTGGCGGATCACAGTAATGTATTTTTTTTTTTATATAATTCGAG
CTCTACACTCAAGCATACATATATAGAATAGCTCAGTTTTAATGGGCTTTCTCGAGAACT
ATTCACCCAGAAGGATATCCTGAGCCTTATATTTAGATGTAACTTAGTAAAGTGAGAGTA
TTATGAATAACTTTTGAAGCTAACAAAATATCAGAAATTAAACTTCATTCAAGAATGTAT
TTATCTAGAAACTGGTCTTTGGCAAATGGCTCCGATGGCACACATGCAATGTTCTTGGTA
AAAACTAATTTATTATTAGGCCAGTACAGAATAAAAGTTGTCATAAGAAAACTTCATTAC
ATTTTATCTCCTCTGGCAAGTATCCAAATTCGAAAACCTCAGAAACCAGCGTTCCACCTA
AAGTTTGTTTGCCCGTATGTTAAAACAGTAGCTGCCAAGTCACTTGAGTTTGAAGAATAA
TCTGATGCTTTTTACATAGAGGTCTATTAGGCTCTTTACTTTGTAAGCATCTCGACTTAA
AAAAAAAATCTATTGTTTTTACGGGCATCGCTGAAAAACTGTGTCTGTTCTCTTTGATGC
TGTCATCTAAGATTCAATTAAAGTCGACCATCAAGTTCCCTTAATAATATCCCTTGTGAG
AGCTTAATCTAAAACTACAAAAGCGTTCGCAACAAGCAGT
Chr coordinates Chr XIV from 746943-748766
w3c xhtml validator w3c css validator