Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNR066C
Systematic Name YNR066C
Strain S288c
Description Putative membrane-localized protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNR066C YNR066C
CAGAATATATCCACGGTATTCATATGCTACCTATCACACCAGTTTCTTCTAATATTCGTT
CTGAGACTTTCGTCGAAGAAGAATGGCAGACTAAAATCGAGCCAATTATTGAATCGATAG
AAAGCGGCTGGACAGGCATATTGAAGCTGAATCAAGCACTCTTCGACCCAGTAGATTCGT
ATGCATTTTTCAGTGATTCAACTTTTGATTCATCCACATATTTGGATAACGGAATGAGTC
GCACATGGGCATTAGCATTTTCAGGGGGACTGGCCAACTCAATTGCTTAGAAAGAGAACT
TGGCAAGCAGGTCTGTCGAGTCTTTCCCACTACATACATATTTTATAGAATAAATCATTT
TTACTTAACTTGAAAGTTGTTGCGTTCGAAAAGACCACGGCTAACGGAGACCACTTAGGT
AAATGCATGCCAGTAAGAGGTATATTAGTACTTTAATGAATGAACTTAGCAAGGTAATGC
CTGCACTAAAATAAAATTCTAACGTCATCCTAAGAAGCATCAATTGGACATAGTGAGGAA
AAGTTTTCACCATTTAAAATTTGTTTTGCAGAATACCATTCTAGACTATGATCCCTTAGA
GATTCTCATTCTTTAAATATCAGCTTCAACAGCATATCTTTATAGTATTATCGTACTACT
GGCGACATTAGCAAATCAAAGTATTTTTGCTCAGTTTCTAGTTTTATCTGTTTGATTCCC
CATTAGATGGTAAACACGTTGTCTTGATGACTGAAAAGGAAGTGAACATGGTCAACTCAA
AATAACCAGACTCAAAATAATTGCAATTACCTAGGCTAGATATTTTTAGAATATTATGAG
AATATTTTTAGAATATTTGCAACCCAAAATATATTTAAATGCCGCCAATTTGCAACCAAA
AGATTATCCGCTACCTTTTTTTTAGTCATTGAATCGTAGCATAAAGTTCCGAGCTTTGAA
AAAAAGCTTTGAACTAAGAAAAGGTAAGAGATCCTCAATT
Chr coordinates Chr XIV from 755035-753725
w3c xhtml validator w3c css validator