Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DSE4
Systematic Name YNR067C
Alias endo-1,3(4)-beta-glucanase, ENG1
Strain S288c
Description Daughter cell-specific secreted protein with similarity to glucanases, degrades cell wall from the daughter side causing daughter to separate from mother
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DSE4 YNR067C
ATCCCAGTTCAAGTTAAAAACTCTTTTATTTGATAGATGGCTGTTAAAAAGAATGGTTTC
ACTGACGAAGTTTTTATCGCTATTGATATTACAGTATCATTACTGATAAACACCTTAGTT
CTTGCAGAACTGAAAGTGATAAAGCAAGGAAACAGTGCGCAGTAGCAATCTCTTTTACGA
TTGTTCTGCGTTTGCCAAGGTATTCTCAAAATACTTTAAGTACTAAAAACCTAAATAATC
TCTATACATAGAACTTTGAATTTTCATTGTTTAAAAAAATGTACGGAACTGCTAAGAAAA
TGTACAAGGTAGTGAAAGCCCACAGAGAGGTACATTTCAAGTGATAAACTTTGCTTTTTA
GATTTGAAAATGTGAAATCTTACCACTCTTTAAAGCGACCATACTAGTAATAACGCAGGA
ATAGTACCACTAAATGGGTTGCCATCAATTTTATGCGCTGTAAGCTGCGCATATGTTTCC
TACTTAAGGTTATAAGCATAGAACTGGCCTTTCCTTCAGCAAAAGAATAGAATAAGCCTG
CTTGCCAAGAGAACTTGCTCGATAGCGGAGTGCTAGCTATTTTATGACCAATTTGGTATT
TGCTGGCATATTTTTGAAAGATCTGGCTTTCTTTTCTTTTTTTCTCCCCTTTTTACCTGA
ACCTTGTTACCGAGTTCAGCTGCGCTAAGCTCTTTTCGGCTATATTTTGTTATGAAAGCC
AGCAGAAAAGGCACGAAATCTCCCAATTTGGTTACCAAGGAAAAACTAGTTAATCATAAA
GCTGAACCCAAAAAGTTAAAAATAAGAGCTGGGTATGAAAAGAGTAGCAAAGCATATACA
CCATACGAAGACTACAAGCGAGGGTAAAGGACTACATATAAATACTTGGTGCAATTTGTT
TCAAAAATGAATATCAAGTATGTTTCTTGTGCTTGTTTCAACAAGTAGATAACCATAGTA
ACGGTCTGCATACAGAAAAGAAAACAAAAAAACAGCTAGT
Chr coordinates Chr XIV from 759099-755746
w3c xhtml validator w3c css validator