Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNR068C
Systematic Name YNR068C
Alias BUL3
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNR068C YNR068C
AACACAGTCACCCTTTGGAATCCAAAAAACGACAGAAAGAATTTTGAGAATGGTAGATAT
GGCAGCGAGTTGGTCATATAATCATGAAGACGTGAACACGGGGGAAGACCTTTGTGGATT
TTTTGACTCCATTGATAAAACAAGCTTTGGATTACCGAATAGCAGGATACTAAATCCAGG
TGATAAACGTAAGAAATTTTTCACTTTTAAAATTCCGAACCAGTTATTAGACGTAACCTG
TAAGCACGGTCACTTCTCTCACTCTCTTTTGCCCCCTACATTAGGGTTTGATAGACCATC
GAGTTCTCATCCAGAGCTTTCTACTCTAAAATTTTCGGAGAGTTTAGGTTATGGTCGTTT
GTCAGAAAGAGGTTCCTCACTATGGTTAAACGACAGTTCTAGTGGCAGCTTAATAAATTA
CTCAATAAATGCTATGATAGTAGGCAAAGACGTAGCTTCTGGGCGTGTTTGTTTAATGAG
TGAAAAAAAGTATAGCATAAGGATAGTTCCATTTGGCTTTCAAAACAATCCAATTAGTAG
GGAGAAGTGCCTCAAAGACTTAGAGGATTTCGATATTGAAATTGCAAACAGGCTTGGAAT
GATCGAAAAAGTCTTTTCTAAAATAGAGCGAGCGATTCCCATTCATAAGGAGGACATACA
GGAGGCGAATCGCTCTGATCAACTATCACCCCTAAGAGGTAAGTATGAATGGAACGCGGT
AGCTGGAAATACTGAAAACGGAACACTTAAAAAGAAACACTAGTCTGAAGAAGATAAAAT
TCAAACTGAAATTACTTACTCTATAGCATCTCTCTTCAACACAGGTCTGAAAAATGTGTT
TCTCAAAAGTGTGCGTAATATTCCTTCATCTCAACCAGATGATCCCACTTCAAAGACTAA
CTCAGAGAAAATTGGGCTTATAACAATAAAAATAAAGCCCCCTAGTAATGCTTTGCCATA
TTGGTGTCCAAATCTAATTCAAAAACAAAATGTATTTTCA
Chr coordinates Chr XIV from 760885-760067
w3c xhtml validator w3c css validator