Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MAN2
Systematic Name YNR073C
Strain S288c
Description Putative mannitol dehydrogenase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MAN2 YNR073C
TTTATACCGAAGTTTTGTTATATAGAGATACAGATATCAACAGGATTGACCACCTTCTTT
TTTAAACCTAGTATAATGGGGACGGTGAGAATTAACAGTTAAGGTATAGGCGTGATGCCA
TGGGAGGGGCAAATACGGAACTGGAGTAAAGTATTGTGTGGTTTAGGTGCTGGGAAAAAG
AAAGCATTAGAATGCTCAATAAAACAGCGGCTTCCCGCATAATATTTTTTTGATTATTTC
ATTCCGAGAAAGGCCGATATATGCAGAGGCTACGTGTTGCTTGCCAACTTCAGTATACTT
TGCTTGCCACTACCAGAAATTGACCCCGGGAACTTTATTTTTTAAGTGCCTAAAACTTAT
TTTCCTGCAGGGCGCGCAATAAATAAGGGATATAGCAAAACTTGAAACGTGGGGTAGTTT
CGTGCCTTCTTATGTGCCTATCTTGATTTTTGCCTTTGTACCTGAGTCTCCTTACCCCGC
GATACCCCACCGTATAGTCACTTTCCCTTGGCACGGGCTAAAATGACCGTAGGATGAGCT
CAGCAAACAGTTCATTCCACGTACACTTTTCTTTTATTTTTAGCTCGCCACTTTTTTGAT
TCAACACTCCCCCCCATGATACGTCATTTTATAAACTTTTCGTGCGGACGTGAACCAATT
AAGCTTGCGCATCAGTGGTGGATATATGGACGGATACCTCGTATATTCTGCTGTGGTGGT
CGGAGAGGGCATCGCAAAGTCTAGAAATAATCAAGAATCACTTTTAGCGTTTCCAAATAA
GTTCGAAACAATCATATTCTAGGAGGAAGGAGGTTACAGTGGTTGCAGACTCATAGTTCA
AAATTCATTCATTTTTTGCATATAAATAGCGAACATTTATTATCCAATTGTTAAGATTTC
CACTTCGTCTAGATCTTTCCGTATAACTCCAATAAAAATAAACAAAAATAATCAGAGAAA
ACTAAAAAGAAAAAGTAACAATTTAAACAAAAAAAAAAAT
Chr coordinates Chr XIV from 776300-774792
w3c xhtml validator w3c css validator