Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MAN2
Systematic Name YNR073C
Strain S288c
Description Putative mannitol dehydrogenase
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>MAN2 YNR073C
ATGACAAAATCAGACGAAACAACAGCTACCAGCTTGAATGCCAAAACTCTAAAGAGTTTT
GAATCCACTCTTCCAATACCAACTTATCCAAGAGAAGGTGTTAAACAAGGTATTGTTCAT
CTGGGAGTCGGTGCATTCCACCGTTCCCATTTAGCTGTTTTCATGCACCGTCTGATGCAG
GAGCACCACTTAAAGGATTGGTCCATATGTGGTGTTGGTTTAATGAAAGCAGATGCACTT
ATGCGCGATGCCATGAAGGCCCAAGATTGCCTATACACCCTTGTGGAGCGTGGTATCAAG
GACACTAACGCTTATATCGTCGGTTCTATTACTGCTTACATGTACGCTCCCGATGATCCA
AGAGCTGTTATTGAAAAGATGGCCAATCCAGACACACACATTGTTTCTTTGACGGTCACA
GAAAACGGTTACTACCACAGTGAAGCAACAAACTCCTTAATGACAGATGCTCCCGAGATT
ATCAATGATTTGAACCACCCAGAAAAGCCAGATACTCTGTATGGGTATCTATATGAGGCC
CTGTTGTTGCGTTACAAGAGAGGTCTTACCCCATTCACTATTATGTCATGTGACAACATG
CCCCAAAATGGTGTCACAGTAAAGACCATGCTTGTTGCATTTGCCAAGTTAAAGAAGGAT
GAGAAATTCGCCGCCTGGATTGAAGACAAGGTTACTTCTCCTAACAGCATGGTGGACCGT
GTGACCCCACGTTGTACCGATAAAGAGCGTAAATACGTTGCTGACACCTGGGGAATCAAG
GATCAATGTCCCGTTGTCGCAGAACCTTTCATCCAATGGGTTCTTGAAGACAACTTCTCC
GATGGCCGTCCTCCATGGGAACTTGTTGGTGTTCAGGTCGTCAAGGATGTCGATTCCTAC
GAATTGATGAAGTTGCGTCTACTTAACGGTGGACATTCTGCTATGGGATATTTGGGATAC
TTGGCAGGCTACACCTATATACATGAGGTTGTCAACGACCCAACTATCAACAAGTATATC
CGTGTTTTGATGCGTGAGGAAGTTATCCCATTATTGCCTAAAGTGCCAGGTGTTGATTTC
GAAGAGTACACTGCATCAGTGTTGGAAAGATTCTCCAATCCAGCTATTCAGGACACTGTC
GCACGTATTTGTTTGATGGGCTCTGGTAAGATGCCTAAGTATGTTTTGCCATCAATTTAC
GAGCAATTGCGTAAACCAGATGGTAAGTACAAGTTATTGGCAGTATGTGTTGCTGGCTGG
TTCCGTTACCTGACTGGTGTAGACATGAATGGGAAGCCATTCGAAATCGAGGATCCTATG
GCACCAACCTTGAAGGCAGCCGCAGTTAAGGGTGGTAAAGATCCTCACGAACTGCTCAAC
ATTGAGGTGCTTTTCAGTCCTGAGATTCGTGACAACAAAGAATTCGTTGCACAGTTGACC
CACTCCCTAGAAACAGTTTATGATAAAGGGCCAATTGCCGCTATTAAGGAAATTTTAGAC
CAAGTGTGA
Promoter Sequence
Download FASTA
>MAN2 YNR073C
TTTATACCGAAGTTTTGTTATATAGAGATACAGATATCAACAGGATTGACCACCTTCTTT
TTTAAACCTAGTATAATGGGGACGGTGAGAATTAACAGTTAAGGTATAGGCGTGATGCCA
TGGGAGGGGCAAATACGGAACTGGAGTAAAGTATTGTGTGGTTTAGGTGCTGGGAAAAAG
AAAGCATTAGAATGCTCAATAAAACAGCGGCTTCCCGCATAATATTTTTTTGATTATTTC
ATTCCGAGAAAGGCCGATATATGCAGAGGCTACGTGTTGCTTGCCAACTTCAGTATACTT
TGCTTGCCACTACCAGAAATTGACCCCGGGAACTTTATTTTTTAAGTGCCTAAAACTTAT
TTTCCTGCAGGGCGCGCAATAAATAAGGGATATAGCAAAACTTGAAACGTGGGGTAGTTT
CGTGCCTTCTTATGTGCCTATCTTGATTTTTGCCTTTGTACCTGAGTCTCCTTACCCCGC
GATACCCCACCGTATAGTCACTTTCCCTTGGCACGGGCTAAAATGACCGTAGGATGAGCT
CAGCAAACAGTTCATTCCACGTACACTTTTCTTTTATTTTTAGCTCGCCACTTTTTTGAT
TCAACACTCCCCCCCATGATACGTCATTTTATAAACTTTTCGTGCGGACGTGAACCAATT
AAGCTTGCGCATCAGTGGTGGATATATGGACGGATACCTCGTATATTCTGCTGTGGTGGT
CGGAGAGGGCATCGCAAAGTCTAGAAATAATCAAGAATCACTTTTAGCGTTTCCAAATAA
GTTCGAAACAATCATATTCTAGGAGGAAGGAGGTTACAGTGGTTGCAGACTCATAGTTCA
AAATTCATTCATTTTTTGCATATAAATAGCGAACATTTATTATCCAATTGTTAAGATTTC
CACTTCGTCTAGATCTTTCCGTATAACTCCAATAAAAATAAACAAAAATAATCAGAGAAA
ACTAAAAAGAAAAAGTAACAATTTAAACAAAAAAAAAAAT
Chr coordinates Chr XIV from 776300-774792
w3c xhtml validator w3c css validator