Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OPI10
Systematic Name YOL032W
Strain S288c
Description Protein with a possible role in phospholipid biosynthesis, based on inositol-excreting phenotype of the null mutant and its suppression by exogenous choline
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OPI10 YOL032W
GCGCTATTTGGCTGGTCTCCTCCAAGAGATCTGGCTTCGAAAAAGCATGAGTGTTTTTCA
ATGGAGGAATTGGAAACCATTTTTAATTTGAATGGTTTGACGAAGGGAAATGCCAAAGTC
GATGATAAAAAATTGTGGTTCTTCAATAAGCATTTTTTGCAAAAAAGAATACTTAATCCT
TCTACATTGAGGGAGCTTGTCGACGACATTATGCCTTCTTTAGAGTCCATATATAACACA
TCTACCATAAGCCGTGAGAAAGTAGCTAAAATTTTACTGAACTGTGGTGGTTCTCTATCA
AGGATTAACGATTTTCATGATGAATTTTATTATTTTTTTGAAAAGCCCAAATATAATGAT
AATGATGCTGTCACGAAATTTCTAAGCAAGAACGAAAGCCGCCACATTGCTCACTTATTG
AAGAAGCTTGGACAGTTTCAAGAGGGCACCGATGCTCAAGAAGTCGAATCTATGGTCGAA
ACGATGTATTATGAGAACGGTTTTTCTAGGAAAGTCACGTATCAGGCAATGAGATTTGCT
CTTGCGGGATGTCACCCAGGTGCCAAAATAGCAGCCATGATAGATATTTTGGGCATCAAG
GAAAGTAACAAAAGATTATCCGAAGGTTTACAGTTCTTGCAAAGAGAGAAAAAGTAATAA
TAATATTAATAAAAGGTTTCGATACAATAGGGTCATGTAAATACGTCATATACATAATGT
AATTAGCCACTACTGTATACGTTTATTTTGTTATTATGATTAAGCTTGATTAAGTTTAAT
TAAGTTTAATTGAATTTTCTTAATGAAGCCGACCGAACGTTCTGGAAGAGTTATATAGGA
ATCGGGTACTAAAAGCGAAATTTGGGGATAAAAGGAGAGATCTACATTTTATTTAAAATA
CGTCAATTCGACTCACCCTTTAAATACGAAAATAAGTGGTCTAATAAATTTGCAAATTCG
GAGATTGATAAGAAATATTTGAGTGAGAGAAAATAAAGAA
Chr coordinates Chr XV from 265429-266169
w3c xhtml validator w3c css validator