Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRE6
Systematic Name YOL038W
Strain S288c
Description Alpha 4 subunit of the 20S proteasome; may replace alpha 3 subunit (Pre9p) under stress conditions to create a more active proteasomal isoform; GFP-fusion protein relocates from cytosol to the mitochondrial surface upon oxidative stress
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRE6 YOL038W
GTAACACCCCAGATGCCACCAAGATTAAGGCTATTTTGGAATCCGTCGGTATCGAAATCG
AAGACGAAAAGGTTTCCTCCGTTTTGTCCGCTTTGGAAGGTAAGTCTGTTGACGAATTAA
TTACTGAAGGTAACGAAAAGTTGGCTGCTGTTCCAGCTGCTGGTCCAGCTTCTGCTGGCG
GTGCTGCTGCTGCCTCTGGTGATGCTGCTGCTGAAGAAGAAAAGGAAGAAGAAGCCGCTG
AAGAATCTGACGACGACATGGGTTTCGGTTTATTCGACTAAGGTTGAGTAAATTTGTGCA
ATCTCGTTATATCATATCTTGGAAGTTATAGAGGGAAGGGCGCAAAAATAAACCCTTTCC
TCTTTTTTACGGCGACCATACTCTTTTTTTCCTAATCCTTTTCAAGTTTAAATCCATGAT
TTAATATCTATTTATACATATAAATAATATAAGTAATGGTTTAATGCATTGTTTCAAAAA
AAAAATAAAAAAAAAAGGGAAGAAATTATATATAAATATACTTCTTCATCTTCAAAATTC
AAACCGATTGTTTTACTGGTTAGAATATTATGTGTGCTCTTTCTTTGCTCTATGACATGG
CTCTGTTTTGTACCTTCCTTTTTTTTATGCTATTGAATAAATTTGTTGTAGCCGCTTTCC
TCAGGAAGGACCCCATGTATTTCATCAAATCATATAAGTTGAATATCCCATCAATTGCGT
ACCTAGTACTTAAATAAAATACTCACGTCGCTTTCTTTGAATATTTGGAAATGAATTGAG
ACCTAGTGTGCTGTGTGCCCTTGTTCATTGACGATTAAAGCTTTAAGGACCATTACTATG
GGTAAGAATATCATCCGGGCAACGGTATTTCTTAATCTTTTCGAAGATTCTTTTGCCACC
GGAAGGGAAAGAAAAGACATCATATATAGGTGGTAGCAAAACCTTCAAGTTAGTGCTCAG
CAGTTCATCAGGATCAGTTGCATAAACACAATTACACAAA
Chr coordinates Chr XV from 255337-256101
w3c xhtml validator w3c css validator