Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRE6
Systematic Name YOL038W
Strain S288c
Description Alpha 4 subunit of the 20S proteasome; may replace alpha 3 subunit (Pre9p) under stress conditions to create a more active proteasomal isoform; GFP-fusion protein relocates from cytosol to the mitochondrial surface upon oxidative stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>PRE6 YOL038W
ATGAGTGGTTACGATAGAGCTTTGTCCATTTTCTCCCCAGATGGACACATTTTCCAAGTG
GAGTACGCCCTGGAGGCGGTAAAGAGGGGTACCTGTGCTGTAGGTGTCAAGGGTAAGAAT
TGTGTAGTATTGGGCTGCGAAAGAAGGTCTACTTTGAAGCTGCAAGACACTAGAATTACG
CCTTCCAAAGTTTCCAAAATTGACTCGCATGTGGTGTTGTCATTTTCTGGTTTAAATGCA
GATTCCAGAATTCTTATCGAGAAGGCTAGAGTGGAGGCCCAAAGTCACAGACTAACGTTG
GAGGATCCCGTGACGGTGGAGTATCTCACACGTTATGTCGCTGGTGTGCAACAAAGGTAC
ACGCAGTCAGGAGGTGTTAGACCATTTGGTGTGTCGACGCTGATTGCCGGCTTCGACCCG
AGAGATGATGAACCCAAGCTTTACCAGACCGAGCCAAGTGGTATATACTCTTCGTGGTCC
GCTCAGACCATTGGGAGAAACTCCAAGACGGTACGTGAGTTTTTGGAGAAGAATTACGAT
CGCAAAGAACCACCAGCCACAGTGGAAGAATGTGTCAAACTTACTGTAAGATCTCTGTTG
GAGGTAGTTCAAACAGGTGCAAAAAATATTGAAATCACTGTTGTTAAGCCGGACTCAGAT
ATTGTTGCGTTGAGCAGTGAGGAAATTAACCAGTACGTCACCCAAATCGAACAAGAAAAG
CAAGAGCAGCAAGAGCAGGACAAAAAGAAAAAATCTAACCATTAA
Promoter Sequence
Download FASTA
>PRE6 YOL038W
GTAACACCCCAGATGCCACCAAGATTAAGGCTATTTTGGAATCCGTCGGTATCGAAATCG
AAGACGAAAAGGTTTCCTCCGTTTTGTCCGCTTTGGAAGGTAAGTCTGTTGACGAATTAA
TTACTGAAGGTAACGAAAAGTTGGCTGCTGTTCCAGCTGCTGGTCCAGCTTCTGCTGGCG
GTGCTGCTGCTGCCTCTGGTGATGCTGCTGCTGAAGAAGAAAAGGAAGAAGAAGCCGCTG
AAGAATCTGACGACGACATGGGTTTCGGTTTATTCGACTAAGGTTGAGTAAATTTGTGCA
ATCTCGTTATATCATATCTTGGAAGTTATAGAGGGAAGGGCGCAAAAATAAACCCTTTCC
TCTTTTTTACGGCGACCATACTCTTTTTTTCCTAATCCTTTTCAAGTTTAAATCCATGAT
TTAATATCTATTTATACATATAAATAATATAAGTAATGGTTTAATGCATTGTTTCAAAAA
AAAAATAAAAAAAAAAGGGAAGAAATTATATATAAATATACTTCTTCATCTTCAAAATTC
AAACCGATTGTTTTACTGGTTAGAATATTATGTGTGCTCTTTCTTTGCTCTATGACATGG
CTCTGTTTTGTACCTTCCTTTTTTTTATGCTATTGAATAAATTTGTTGTAGCCGCTTTCC
TCAGGAAGGACCCCATGTATTTCATCAAATCATATAAGTTGAATATCCCATCAATTGCGT
ACCTAGTACTTAAATAAAATACTCACGTCGCTTTCTTTGAATATTTGGAAATGAATTGAG
ACCTAGTGTGCTGTGTGCCCTTGTTCATTGACGATTAAAGCTTTAAGGACCATTACTATG
GGTAAGAATATCATCCGGGCAACGGTATTTCTTAATCTTTTCGAAGATTCTTTTGCCACC
GGAAGGGAAAGAAAAGACATCATATATAGGTGGTAGCAAAACCTTCAAGTTAGTGCTCAG
CAGTTCATCAGGATCAGTTGCATAAACACAATTACACAAA
Chr coordinates Chr XV from 255337-256101
w3c xhtml validator w3c css validator