Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NTG2
Systematic Name YOL043C
Alias SCR2
Strain S288c
Description DNA N-glycosylase and apurinic/apyrimidinic (AP) lyase involved in base excision repair, localizes to the nucleus; sumoylated
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NTG2 YOL043C
CCCGGTAGGAGCTGCTTAATGATCTTTGATAACTCTCTCATTATAATCATGCATTGTGTT
AGCTTAACTTCGTCATATTTCCAATACAAATGAGTATTTAAAACGACAAAAATAGTACCC
GTCTCCTTATGTCTTAGAGATACGAATAAGCATACCTGATTCTTGCCTTTTAAAACATCC
AATAAGCTGTCTTCACCAATAACATTGGAAGCACCATCGGTTAATGTTACCTTCTTATTG
TATAAGTATTTCAGTTCCCTTTGATTGAAAACATTCAGTAGCTGGTTTAAGTAGATCCCT
GATGACGATATAAAGTCAAATTTTGCAAGATTATAGAAAATAGATACACCGTCCATATCT
TTAACCGGTTTTTTCCAATACTTTGGGGGTGTCTTGGAAATGAATTTGGACCCATAATTG
ACATCTACCCCTATGGAATCGTGCCAATAATCTTCATAATCTCTTGCGGTCATTTCTTGG
AGACACATAATATCAGCCTTGAAAGTATTCAAAAGTTCTTTCTCCAGCAGTCTGTGCCTA
TAACTCCAGTTTTTGTATGGCTCTGCAACGTATGTGTATACCTGTGGCCACATATATGAC
GGTGAGAGCATGTTGTATGTTAATAAAGTGAACCTAGCATCTTTTCGCACATATTTACCG
ATGTTTTGCTTAGTTGACTGAACAACTGGAATAAACCTTCGAGTAAACATTGTTACTTGT
ATGAGCAGTAAATCTCTCTCCAATGTTCTTTTTTGCCGTTATCCAGCTTAGTTTGTGTAG
ATCTCCTTTCTTCTCTAACAGGAACAATTAAACAACTCATGGTTAATTTGTTAGTTTTGT
TGCCGAGAAATCAAAATCAGCTGGTGAAGCAGTTATCCTAACTTGGGAATATACATGTAG
TAGAAAGGAAGGAAGGCAAGGACCTCTTTAGCATTTTGAATCTGTTGCTTATTGGGAGCA
CACAAAAAATGTATAAGCACAACGTCTTTCACAGTATATA
Chr coordinates Chr XV from 249534-248392
w3c xhtml validator w3c css validator