Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LDS2
Systematic Name YOL047C
Strain S288c
Description Protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm in a punctate pattern
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LDS2 YOL047C
GACCTTCTTAAGATGGTCAACCTTACTCCCAGTGAGTTTGGTGATATGGGATTATACGAA
AATGCATGCGGCGACTCATTAGGTACAGCAACAAGGTCCGAACGATCATCATCACTGAAT
GTTGACGAAAACGAATCGACGGACGAGGAAGCGTGTTGGTACAAGCATGGAGGTTTAGAG
AGCCCTACCAACGGGGTATTTTTAGAATATGAAATGTCGGCAGGAGCGGCTGCACTAACC
GGGTATGTCATTGTGTTCTTTGTTTATGATTCTTTACTTTAATCTAGCAGGGCAGAGGAG
TAACAATAAAACGCCCTGCAAAGAAGTATGATTACTGTTCTTGCCAGACTTAGAATTCTA
AGTGTTAAAAGTCACCAATAAGGAAGGAAAAAAGTTTATGATAGTTTATACTGTTGTTGT
TACTACCTGCTCCGTTATGTTTCTAACAAGGAATAAAACAGGGTATAGACGTGATGTCAG
CTTAAAGAGGAAAACGAAATATGTAAACTTTGTTAAAAATAAACAGGGCCCCTTATTGAT
CGTTCGCGATGCTATTATTTTATAAGCCAGCCTTTATCGTTTCTTTTGATCTTGTTTCTT
TTTCTTGTTTTTTTTTTTAACTTCGTTCTCTTTTCACGTACTGATTACTCACACCAGGAG
AAAGAAGTTGAAAAATGCTGTTATTCTCTGGAACACGCTATTAGATAGTACTTGCTGGTT
CCGTAGACAAACAGCTCTTGCGCTTTATCACTTCGACAAGTGTCTTTACAGCTTCGCGAT
GACATATCGTCTCTTGCCCCTGCCCCACCTGTAACAATAGCTTGGCCAAAAAAGAAAAAA
ATGTTCCGACGAATTTTTCCGCTGATTTTGGCTGATCGCGTCGCGCCACAAAAACGAAAC
TTCCATAATAAAACATTATATAAAGCTTTTTATTATTATTATTATTACTTTCTTAGTTAT
AGCATTAGAACTATAAGAGCTGCTAAGACACCAAGCAAAC
Chr coordinates Chr XV from 242441-241614,242747-242505
w3c xhtml validator w3c css validator