Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPE2
Systematic Name YOL052C
Strain S288c
Description S-adenosylmethionine decarboxylase, required for the biosynthesis of spermidine and spermine; cells lacking Spe2p require spermine or spermidine for growth in the presence of oxygen but not when grown anaerobically
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPE2 YOL052C
AAATAAAAAAGAGGCCGCCACAATGTAGGGTAATGCCTAATTATATTAACTAGAGACTGA
CTGAATCATATTACTTAGTTACTACTACTCTTATCATGCAAGAAGATGTGAAAAAGCGTC
TTCCCCCAAATCATATAACTTCTGCACCATCCGTGGACTGTACAGGTTCAGCGGGGGAAT
ATGTAATTGCTTGTTAGGATTGCTCTTGGGACCGTAGTATCGCGACAAGGAAGTCTGTGT
AGTTCCACTTGATGTGGGCTGCCTCGCCGCTTCTTTTGCAGTCCCTAACCTTATATAGAT
GCGCACGCGCCAAAGCATGAGGGTACTCCATCATGTCTGTTGCACAAATATCGTAGGTTA
CTTGACGCTAACGTCATGTTTGATGCTCCGTTAACGAAGAGAATCGGAGCTCTTCATCTT
AATCAGGCTCTTTTATAGCTCAATCATCAGTGGAAAAAATTCTTCGAACTAGAAAAAAAT
CAAGAAGTGAAAAAACTAAAACCGCCAACTGGCTACCCGGATAAGCCCCATAATGGCGTT
CCTAGGGCTAGAAGAATTTCAAATCGATGACAGCTGATAGAAAGCGCCAGAGATATGTAG
CCTTCCATCAGTAGTAATATCCAATAAATTGGGCACCATGGTTTGGCAATCAGGCTTTTT
ACCCTCGCCCTCTTTTCCTTCGCCTTTTACCTCTTCTGCATCCAATTTCAGCGTACGTAC
ACAATGATTGACTTTGGAAATTTTCACTTTTTTCCACTCGAAGAAAAAAAATTCCAAACA
CGGTTCTCCGGTATTTAGGCATCGAATAAACTTTGCTAATCGACTAAAAGCATCTCTGCA
TATCTATACGTGTATATATTGTATTCGCTACAGCTCGCTCCTTGCATCAACTCTTTTTTT
CTTTTTTTTCTTCCAGGTTAATCAATTACTGTACTGTAGCTTCTTTTTTATATTTTTTAG
GTTTTCATATAGTGTCTTACGCAAATAGGCGGACCATAGA
Chr coordinates Chr XV from 233636-232446
w3c xhtml validator w3c css validator