Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARG1
Systematic Name YOL058W
Alias ARG10
Strain S288c
Description Arginosuccinate synthetase, catalyzes the formation of L-argininosuccinate from citrulline and L-aspartate in the arginine biosynthesis pathway; potential Cdc28p substrate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARG1 YOL058W
GGTTGCCACATACATGGCCAAGACCGGTAAGTCAGCCTTGGAAGCAGAAAAGGAATTGCT
TAACGGTCAATCCGCCCAAGGGATAATCACATGCAGAGAAGTTCACGAGTGGCTACAAAC
ATGTGAGTTGACCCAAGAATTCCCATTATTCGAGGCAGTCTACCAGATAGTCTACAACAA
CGTCCGCATGGAAGACCTACCGGAGATGATTGAAGAGCTAGACATCGATGACGAATAGAC
ACTCTCCCCCCCCCTCCCCCTCTGATCTTTCCTGTTGCCTCTTTTTCCCCCAACCAATTT
ATCATTATACACAAGTTCTACAACTACTACTAGTAACATTACTACAGTTATTATAATTTT
CTATTCTCTTTTTCTTTAAGAATCTATCATTAACGTTAATTTCTATATATACATAACTAC
CATTATACACGCTATTATCGTTTACATATCACATCACCGTTAATGAAAGATACGACACCC
TGTACACTAACACAATTAAATAATCGCCATAACCTTTTCTGTTATCTATAGCCCTTAAAG
CTGTTTCTTCGAGCTTTTTCACTGCAGTAATTCTCCACATGGGCCCAGCCACTGAGATAA
GAGCGCTATGTTAGTCACTACTGACGGCTCTCCAGTCATTTATGTGATTTTTTAGTGACT
CATGTCGCATTTGGCCCGTTTTTTTCCGCTGTCGCAACCTATTTCCATTAACGGTGCCGT
ATGGAAGAGTCATTTAAAGGCAGGAGAGAGAGATTACTCATCTTCATTGGATCAGATTGA
TGACTGCGTAGCGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGTC
TCAATAGTATATTAATGGGCATACATTCGTACTCCCTTGTTCTTGCCCACAGTTCTCTCT
CTCTTTACTTCTTGTATCTTGTCTCCCCATTGTGCAGCGATAAGGAACATTGTTCTAATA
TACACGGATACAAAAGAAATACACATAATTGCATAAAATA
Chr coordinates Chr XV from 219211-220473
w3c xhtml validator w3c css validator