Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name APM4
Systematic Name YOL062C
Alias AMP1
Strain S288c
Description Cargo-binding mu subunit of AP-2; AP-2 is a heterotetrameric endocytic cargo-binding adaptor that facilitates uptake of membrane proteins during clathrin-mediated endocytosis; Apm4p is required for AP-2 function and localization, and binds cell wall stress receptor Mid2p; AP-2 is required for cell polarity responses to pheromone, nutritional status and cell wall damage in S. cerevisiae, and for hyphal growth in C. albicans; AP-2 complex is conserved in mammals
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>APM4 YOL062C
AACCCAGGGAACTGTGGATCGTGCAAATCCATTGTGATCACATGGTCAGCACCTGCAGCA
CTCAACAAATGAGCAATCAAAGTACCGGCTTGTACTACCCATAGCTTATAGCCTGCATTT
TGAGCGTTGAACAATTCACCAGCGTCCGTGCTATTGCTTGTATTTTGTAACTTACCACCG
GGAATCATAGGAATTCTTGAAAAAGAAAGCGTCTTCTTGATGTCGAAATTGTTATTCGCC
GTAGCACTGCTGTTTGGTGTTCTGATAGGTTGAGGATTTTCTAAGTTGATAGTTGATCGT
ATTGCACTATCCAAACTCTTCAACGAGCTCTCAGCACCTGGTCTTTGCGTCATTAAAGAA
GATGACACGGGTGTGCCTGGATGCGATTCAAAAGTATAGTTTTCTTTAGGCTTGGAAATT
ATGGGAGCACCCTTGGCAGTATATGGAATATCTGGCTGTCTCGAGTAGCAGAGATATGGC
ATTACGGCTGTAACCCTCGAGGCAGAAGCGGACTTGCAGGCACTGATTAAAATCAGCAAC
TGCATGAACGTGTCGTTCACCTGGCCACAACCACTCTGGATGATATATACATCCTTTTCA
CGAACAGATTCGCGAAGAGCAATGTTCGTTTCCCCATTAGAAAACTTCCCTAATTCTACT
TTCGATGGGTGAATGTCCAAATTTTCACAGATCTTAGTAACTAACTCGGGGTGCGAGTCC
CCTCCAAAAACAACAATATTACTCATTGACATCCAGACTGCGTTCCTAGCCTCGTAGCAA
CCTCCAACAAAGTCACTTTCGACCAACTTACTCTCATCTCATCCAGCCCTTCTCGCTAAT
CGTAGCCATTTATTATTTGATAGAAAATTTTTTTCAACTGCGGTCGAAGGGTAACAGCCA
TATTTTCCTTAATTGATTAGTATAGGAGAACTTGATGATAAAGTGTGGAAACCTTTCATA
AACGGTTGGAGAAAAGAATCACATAGAGTTATGGTGAGCA
Chr coordinates Chr XV from 211995-210520
w3c xhtml validator w3c css validator