Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MET22
Systematic Name YOL064C
Alias HAL2
Strain S288c
Description Bisphosphate-3'-nucleotidase; involved in salt tolerance and methionine biogenesis; dephosphorylates 3'-phosphoadenosine-5'-phosphate and 3'-phosphoadenosine-5'-phosphosulfate, intermediates of the sulfate assimilation pathway; human homolog BPNT1 complements yeast null mutant
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MET22 YOL064C
CAGAAGAGGACGATGTCAATAGCGACCCTGAAAATGAAGAATCTGGTAGCAGCTTAACAA
GTTTCCAGCGAAGATATAGGGATACTGAACAGCGTGCTCACTTGAAATCAGAATCGCAGA
AATCTTGGGGGTTCCACAACTATGTAAGAAACGTCAAGCGGTTATTAGAGTCAGCAGTAC
CGGGCTCAGAAGATTCGCCTCTTGGGTATCAACTATCCGAAATGCACGACGAGTTCTTCT
TCCTAACCACAGCCCATAGGCTGGTGTTGATGAAAGCAAATCCACTCATAATTATATCAG
CAACTCATCATGAGATTTTTCCCTTAGATGGTGTTGTGACGTGTGCTTCCAAGTCGCTGC
TCCAAGCACTAAACAGAATAAATTTTGTGTGTCACATCAAAGAACTAAATTGCATAGCCG
TGGCTTCACAATTGGGTCTCATTTCATTACTAAGACTAACAGAGTACAGAGGCATCTATT
CGTTTAGACAAGAGTATATTCTTGGATGGGAAGTCCAAGACCCTGTTAACCCTAGTCCAG
AGTGCAGATGTAACAGGAACTTGTTTGACGCACCAATGTATGGTGCAGATGGAGAGAGCT
CGGACACATACTGCGGCGTGTGCGACGTCTATTTCCCCATGGGTGATATTTGCGGACTAG
ATTACACTTATGCATCTGACAGTGAAGAGTTAAAACGTAAGGGATATGCTACCTTATACG
TAGCATCAAGAGGCTCCTTGAGGGCATTCAAGATCACAACTGAGCATGGAACAACTCAAC
AATAGCATATTTTGACATTTACATAGCCATCTATATAATAATCCTTCCTTCATTGAAATG
CGCGAATGACTCAGACGAGCAATATCACGTGTTGCGATTTTACTTTCAGTTTGCAAAGAA
GAAACCATGCCACATATAAAGAACGTTTGCACTTCTCTTTAATTTATTAGTTAGTAAGTA
AGAAGTTTAAAGACAACTCAGAAGACATCAGCACTTTACT
Chr coordinates Chr XV from 207176-206103
w3c xhtml validator w3c css validator