Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG19
Systematic Name YOL082W
Alias CVT19
Strain S288c
Description Receptor protein specific for the cytoplasm-to-vacuole targeting (Cvt) pathway; delivers cargo proteins aminopeptidase I (Lap4p) and alpha-mannosidase (Ams1p) to the phagophore assembly site for packaging into Cvt vesicles
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATG19 YOL082W
ACACCCTGTTGGTTTACGAGAAACGTTAGGTTTTACAGTAATTACACATTAACGCTTTTC
CTCTCAAACATGGTTTAATTGCTGAAGTCCTTGACATTCAAAGCGACAACTTTGGCCAAA
AAAGTAAGCAGACAGCGCTTTTTATGTGACATATTTCTAGCAAATCTATTATTTTTTCAG
TTTACATATTTTCATCTCCAAAAATACTATCAATTTAACAATCCTCATTTACGTATAAAA
TTACAATGCTCTTGTTTTCACATTTTTCGAATATGTTTCGTAATTGTTACGCGTTCCATT
TGAGAAGCAATTGTGAGTTAATCACTGTCAAAAGGAACTCAGAACGAACAAAATACCTTT
TTCGGCATATTTTTCTGTTCGTAAATGTTTCCAGTTTGTTACATTATCCTTTCTTGTTAT
AAATGAAGTCTCAAACTTTTCTGACTTGGTAAACTTAAATATAGGCACGGGTGTTTAAAG
CCGCCCACACATCACATTGAGAACGAGGTTATTAGTAGTTTGCACATTTCATTAATAAAA
GCACGTTAAACAATTCTTATTATTTACTAAAAACCTACTGATGTAACGTAACCATGTGTC
AAGCATCTATAAATTCTTGCCAAATATTGTCTTTTGCTATCCATAGACCTCTGTAAATGT
TGGGCAACTCGTATCTTAAAAAACAATATCCCGTATATTCGTGATGTAGATGCTTCCTTT
ATAGAGAAACATATAGCACGCTGAGAGTATCATCCATTATAGCGGTTCCATGCGGAACAT
AGCACCAAAGAGGTTATTATTTTCTTAATTCTTATTGTATGACCCGGAAAAGGGGCGTGT
GACATTGCATAGTATATGTTTACCTGAGGAAAAAGGAATTCAAGGCTCACGTAAATCTCC
ATGATATGAGTTTGATAAGGTGTATCAGACGAAAGAAGACTGAATCGAGGTAATTGCGGC
GGCACTTGCTTCAGTAACGCCCAAAGGAGAGTTCTGGTAA
Chr coordinates Chr XV from 168727-169974
w3c xhtml validator w3c css validator