Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG34
Systematic Name YOL083W
Alias ATG19-B
Strain S288c
Description Receptor protein involved in selective autophagy during starvation; specifically involved in the transport of cargo protein alpha-mannosidase (Ams1p); Atg19p paralog
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ATG34 YOL083W
ATGAAAATTGCGGTAGAAACGACACTATTCGACTTCTTTGTCATCGATCAGTTTAAAAAA
TCTACTTTTTCAGCGCCAAACACCAAAGTTGACACTATTAAGGGTTGTATTAACAAGTTT
ATTGAACAATTTAATGTATATGATGAGCAACACATATTTTGGCAACCTCCTGGAAAATCA
AACGTCAGATTGCTGTCAAACGCCAATGACTTTGGCCAATTGGGAAACTTTTTGCATAAG
AAAATCAAATGTAACATTTTTATTGGAGAAGAAGCATTAAGGAAATACGATTTAAATATC
TGTGGACCTTATGACAAATTTGTAGAAAATTCTGACCCTAGTGTTAAAAAGGTTGTGAAC
AGAGATGATGTCATGTTGTCGCGCAAATGTTTAAACATCATATCGGAACAACTCTCTATA
CTTGAGAAGTCCATAAGTAAGGCTCAAAACCAAGTGTTGCAGTCAAGTGAGGTTGAAGGA
AAAAAATGTATTATCTTGCCGGAAGATAAACCAGAACTCATCAAGTTTTTTTCTAAATTT
GAAACGAGTGTTCAGTTACAGGAGGTTTACGAGGGCTATAAGGTATATGAAAAGCTATTA
CAAAAATTTGGTGGGCAAAAAAAAAGAATGGAGTCTTTCTTGAATGAAAACACGCCAATG
TCAGGTGCCGAAGCTATCAAGCAAATAAATATATCTGAGGAGCTCAAGGAAAAAGGGGAA
CGTTTAACAACACCAAACGATCCGTTATTACACGTTGAGGTGAGTAATGAGGATAACTCG
CTGCACTTTATATTGTACAATAAAACGAATATCATAATTCCAGGAAATTGTACATTTGAA
TTTTCTAGCCAAATCTCCGAGGTATTCAGTATCAAAATGGGACCGCATGAGATAGGCATA
AAGGGTCAGAAAGAGCTATGGTTTTTTCCATCATTACCTACTCCTCTCTCCAATTACACA
ATGAAAGTCGTAAACCAGGATGGAGAAACTATTCTGGTTGGTAAATGTGCTGACTCCAAT
GAAATAACTCTAAAATCTCCACTAGCCTCATTTTCGACAGGCAGTTTCCAGACAGGCAGT
TTCCACACTTTGCAAGATCCTACTAATGTTTTCCGGGCAGACGCGCTTTCTTCCCCTGAT
GAATCAAGCATCATGAGCACTCCCTTTCTAGGCGAGACAGATGAAGTTTATAATTCTGGC
TCTACATTAAGTAGGCCATTTACTTGGGAAGAAATATAA
Promoter Sequence
Download FASTA
>ATG34 YOL083W
TCGATCAAGAAATTAAATGATACTGTTATCAAAAAATCAAGCACTCTCTCCTCCTCTACC
AAGGACAACAACGAATCTACTTTTGTTCCAGAGGGTGAAAAGTTTCGCAAGTTTCACTAC
AGCGATGTTGAGGCATTGAGAAATAAGCGCCCTTATGATGAGGATGATCATAGTAAACAT
GGACCTGAAGGTGCCGTGCCAGTAAACGCTGACGCGGGAGTTATTTACAGTGATCCGGCA
GCTGTCATGAAAGAGCCTCAGGCATTTCCTCCGGATGTTTTGGAAACCAATACTTGGACA
AGAAGAATTCTACAATTCTTCAACCCAAGAAGGTCGTATCCTTTCGACAGTGTCAGGATG
AGATTCCCACTTGTTTTCAACACCAGCATCGAATACGATGAAGAATATTTGAGCTCTGCT
TATACCGATCCATGTGTCAGAGAGAAAGATCCCATTGTGTGGTGCTGTAAGGATCCGTTA
GGAGTTTCAAAACAGCAAATTCAAGAGGCTAGGTCTAATGGCTTAGATGTAAGAGATGAT
TTCACAAGGTACGATGAAAAAGGAAAAGTCATATTCACTTACAACCCTCCTGATTATGAA
CCTGAGGCTAAAAAATGATGAATTAGCTTCATTCTTCACTTCTATCTTTTTCTTTGATTT
TTTTTTCCCTAATGCATACATGATTTTTACGTCTTTATATAATACTGTTCTATTCATATT
CTAGCCTAGTTTAATTATAATAATATCTATAATGTTTTTTTATATATCCGCATATCTGTG
AGCTTGGGTATACAGAAAAAAATGGCACACGCACCCCTAAAGTAGGTGGGGAGGAAAAAG
GAAGTAAGAGAAGGGAAAATCATATGAGAGCATCCAAATAGATCACTCTAAAAAATATAA
ACAGGCATGAAACTCAGTCAGTCAAATCAGAGTTAATATTGTAATTATCTGAAACTAGTT
CCTATAGGTTGAGTGTCTATCAAAAATTTACGGAGACGCG
Chr coordinates Chr XV from 165714-166952
w3c xhtml validator w3c css validator