Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHM7
Systematic Name YOL084W
Strain S288c
Description Protein of unknown function, expression is regulated by phosphate levels; green fluorescent protein (GFP)-fusion protein localizes to the cell periphery and vacuole
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHM7 YOL084W
GGAGGGGTGTTACCCCCCTTCTCTACTAGCATTGGACTTTAATTAATATATGTGCATAGG
AGAAGTGTAAAGTTCCCTTCCATATTGTAACATAATAAAGTGCACACCCAAATGAATTGA
AAGCGTACTCAAACAGACAACCATTTCCAGTGTTGTATGTACCTGTCTATTTATACTGGT
AGCAACCCTATTGCTGTTTCCTCTTCAAAGTACTCTAGCGGTTATGCGCGTCTCACCTTC
AAGGTCATGGTCGCTCTATTGTTCGCACCACCGGCAAACTCGCGTCTCGCAAGTCTTGGC
TCATTCTTCTAGTATACTCATGTTGCAAATGCACTCAGGTTCTTTCGGCAACTTAAATAA
TGACACCAGTTGTCGTGGTCGTCATCATCGCAACCCCAACCGGCATTCTTATTGCTTCTC
CAATCTCGCCCCTTAGCGCAGGGTAAACCTTGGAAAATGCAGGCGCAAAAAACTCCGCCG
GGCACAGCCTCACGCCCAGCGTTATCGCCGGGCCGGCAAGAGCGCGGGTCCGCCACAGAG
TCAGCATGATTGTGCAATTGCGTAAACTCGTTTTTTCGGCGCCGCAAAGCCAAATACATC
ATATCAACACTTTTCACTTTATTTTTCGTTCGACCCTTATATTTGTCTTTTGCCTTCATG
CTCCTTGATTTCCTATTTCATTTACCATCATTTCTTCGATCCCCCTCATCGTGATGTAGT
CAACCCTCTTCTTGTTTTAATACGTTAATCTCCCTGAAATACTTTAAATACGTATGTGCG
CAAGTGCTTAGAAACATGTATACATCGAGTATATATATATGTATGTATTCGCTTGATGTG
GGTTCTTGGTTATCTATCCTTTATTGTATTTACTATGTCTACTACGTCTACGATATTTAG
CAAATAGTACTCCTTTTTGTTATACTATTATATTAAGTTATATTTGAGCACATCATATTC
AAAGCAGCGAAAGGTTAGATATTTATAGCACATACGTACT
Chr coordinates Chr XV from 162356-165331
w3c xhtml validator w3c css validator