Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IZH4
Systematic Name YOL101C
Strain S288c
Description Membrane protein involved in zinc ion homeostasis, member of the four-protein IZH family, expression induced by fatty acids and altered zinc levels; deletion reduces sensitivity to excess zinc; possible role in sterol metabolism
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IZH4 YOL101C
TCGGGAAATGTTCGCTTCCATTTGGGGTTATTATTGCTAAACGTCAAAAGTTATTCTAGT
TTATTTCGTCGAATATGATTTCTTTTTGCACGTGACTTTTCTCCGATTATCCTGGGCGGC
TATTTCTCCGCTGTTTAACTAGGGACCAATTATTCCATCAACAATGTGTCGAGTCGATCG
TTAACCATCTGTCATGTTTCATACCTTATTCTAGGCATATATGGGCCCACCATATATTTT
TGAGCCTTAGACTTTTCGTATTTGGGGTACATCAGCTTCCATTGCTACAGAACTATTTGA
GTCTCAACCATTAGCTATAGAGCTAGTCGGAAATGGCGGGACCGAAACAACTTTTGATAG
TACAGGGAACTCCAGCGTATGTTTCTCTAGGTGACAAGAAATAAAACTGGAGACAGGCGA
TTGACAGAAGGATCAGAAGCAATAGTCTTACTACTTATAGACAGAGAAAAATGATTATTC
CATATGTTACCCTGATATTCTACGAGAAAATGGGCCTTCGTCAATAGCTATTTAATTTAA
GCATATGTACGGGCAGTACCAGCTGTTATAGTTTACATAAAATAGACATATTCACGTGTA
TGCAAGGGCACATAAAAGCAAAGGCTGACATTGAAACATAGCAAGCCAAGAGATAGAAAA
GGAGGATACGGGGTGAACAGCCGGTCTATTCTTATATATACTTCAAAGAAGCGATAGTTC
TGTCCGTATAAAAACTCGGACAATTCGGACAGCACTCCGCGAGAAAAGGGCTCGTTGGGC
AGCTCAACATTATTCAACGCAAGCCTGTTGAGCTCAATTGGTTTTAATTGTAAATACTCA
ATGGTGTCAACAGCTAAATGATTTACACTCATATATATGGTCCGGATATATGGACGCAGA
AGTAAAATAAAAATGAAAAAAAGTAGAAAAGGAAATTAATTTCTTAAAGTTCTTGTCAGC
GCATATAATATTGGTATAAAGGTACATATATATTGACAGT
Chr coordinates Chr XV from 127920-126982
w3c xhtml validator w3c css validator