Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SHR5
Systematic Name YOL110W
Alias ERF4
Strain S288c
Description Subunit of a palmitoyltransferase, composed of Shr5p and Erf2p, that adds a palmitoyl lipid moiety to heterolipidated substrates such as Ras1p and Ras2p through a thioester linkage; palmitoylation is required for Ras2p membrane localization
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SHR5 YOL110W
AAGAAGAAAATAGTAAGCGCAACCGTGATAAAAAGCGCAACTGTGTAAAATAACAAGTAT
GTACGTACTAACTATACTAATCTTATTTGGCCAGAGACCAGCCTTTTTGTAGACGCTCCA
TGACTTGCCTAACCGCAGCCTGATCGTTCTCGAAATTGTTCTTCAGAAGAGCCTCGATAT
CATCCCAGGGCACAGTGAGTTCCTGTGGAGGAGCAGGAGCAGGGGAGTTAGTGGATTTCT
CGGCTTCGGGTTCCTTAGATATAGTCGGATTCGGCTTAATCATGACTGTGATTGTGGAAT
TGGCAGGCGTGACCTTCAAATCCGATAAGAACAGGTTATCGTGGAGGACTTTGCCCTTCA
AAAGCAGTTTTATCTCGCTTATGTGGGAGGCCTTTTCCTCGCTGATCAAGTGCTGTTTTA
TTTGTAAGATAGTATCTGATGGGCTGAAATCATGCTCGATGGAGAACTTGGGAGCTTGAA
TTTTCTTTAAGGTTAAGTGGACGGCGGCGTTGTCTTGACCTTGCTGATCTTGGTGCAGTT
TTAACTTCTTGGCACGATTCTGCTTATATTTATACTTCAAAGTAGGCAACGGGACACCCA
AATTGGTAACATCCTTCAGAGGTTTAGTATAGCTTTTTGGTAGCTTCGGTTCAGTTAAAG
TGGCTAAGGTCAAGAATTTACTAACGAACTCGTGTTCTGGACCGCTGGCGGATGTGCTCA
TGATTAATTTTGTATAAAGTTATTATTCTTCGCTAGTTTATCTCTGTATCGGTCTGTTCT
AACCCTTTTCTCCAACTATGTTCTCCTGTGCATGTTTTCTTCTTTTCGTTTTTCCTTTGT
TTTTTTTGGTCGTAGTTGTCGCAAGCTCGGCCTCCGGCCTGATTTTAAAACTATTCCTAA
TTCAAGATTCGGTAAAAAAGATATATAATAGCTAAGGGGAGGAGAGGAATAAGAGGAAAA
AGTTACATTAGAGGACAATACTCAATCTAACCCTTACTAG
Chr coordinates Chr XV from 109176-109889
w3c xhtml validator w3c css validator