Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MDY2
Systematic Name YOL111C
Alias GET5, TMA24
Strain S288c
Description Protein with a role in insertion of tail-anchored proteins into the ER membrane; forms a complex with Get4p; required for efficient mating; involved in shmoo formation and nuclear migration in the pre-zygote; associates with ribosomes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MDY2 YOL111C
CGTTTAACTATTTGGGTCGGGGCACGACGAAATCTAGGGATAGGCACCCGGACCGTCGGG
GCAATACTAGGCGCACACCGCGCTCGTGAAGCAGACCTCCCGGCGAGTTTAGCTGCGCCA
CGTACTGCTCTAACGCGAGAGACTCCTGAAACACAGGTCTAGAAAGAAGGGGCCCCAAAA
CCCAGCTCCACAGACCGCCCGTAAGCATATCGAGCAACAGGCCACTTAAGTTACGCCACC
CGAACACCTCACCTTCTTCACGCAGCAAGAATCCGTTTACCCGGTGCACAACCTCCGCGA
GCTCTGCCGCACTAAGATATTCTGACAGAGGCGAGACGGAGGAGCAGCCAAACACGTGAT
CCCCAATGTCGTAACGCCCGCACCGCACAAAGCTAGTGCCATCGTCGCCCACGATTGCCG
CCGGCTCGCTACCGGGAAGCTGTGTACTAAATTGTGGCGTTTCAAGGCTGCTGCGAGACT
CATCGAACCGCCGGGGCACTCGTACCACCCGGGTCACCTGGAACTCGGCAGAGCCCCGAG
CAGCATACACATTCGGGAAATGTGTAATACACAATTTGTGGTCTTCGTCGTGCTCTGTGG
GTTTAGCGTCTTCGGAACCGAGGTCTTCGTAGAATGAATACGAAAACTCATGGTAATTAA
AAAATAACGCCCTTTCGCTCGTATTTGCGTTATCTTCTTCCTTTTGATGGCTATCGCACA
TCTAGTAAGGGTTAGATTGAGTATTGTCCTCTAATGTAACTTTTTCCTCTTATTCCTCTC
CTCCCCTTAGCTATTATATATCTTTTTTACCGAATCTTGAATTAGGAATAGTTTTAAAAT
CAGGCCGGAGGCCGAGCTTGCGACAACTACGACCAAAAAAAACAAAGGAAAAACGAAAAG
AAGAAAACATGCACAGGAGAACATAGTTGGAGAAAAGGGTTAGAACAGACCGATACAGAG
ATAAACTAGCGAAGAATAATAACTTTATACAAAATTAATC
Chr coordinates Chr XV from 108896-108258
w3c xhtml validator w3c css validator