Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SKM1
Systematic Name YOL113W
Strain S288c
Description Member of the PAK family of serine/threonine protein kinases with similarity to Ste20p and Cla4p; involved in down-regulation of sterol uptake; proposed to be a downstream effector of Cdc42p during polarized growth
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SKM1 YOL113W
GAATTTAATTTTACTTCTGTTTTTCTTTTTATCGCTGTGAACTTTTTTGTCAAGAAGTCG
CTCTTTGTTGGCTTTCTCTTTTATTTTATTCCATTTCTTTGAGGTCTCAGCAGTGGTATC
ATTAGGAAATTGGCACGTTTGCCGAATTTCTTGAACCAACTTCTCGAAGCATTTTAATTT
GTTGGTTTCCCTTGACCTAGTTTCATCAGATTGAATTACTATAGAATCGCTGCCCTTAGC
GTAGTATCGAAACCTGCCGCTACTTAAGATGTTTCTCACTTCCTGAGGAATCCAAGCACA
GTTTGATAAACCAGAAAGTGTCAAAGTACATTTACTATTTACCTTATTAACGTTTTGGCC
TCCTGGCCCGCTGGCTCTATCGTAACGTAAAATAAATTGATTTAAGGGCAAGCCCGTTAC
GTTAAGTGCTCCTACCCAGTTTCTTGCCTGGACGAAGTCAGATTTCTTTCCGATCTTTTT
ATTACTAATCAATCTGACTGCCTCTTCAACGAACTGTTGTTTCTTGCAGTGCAACATTGG
TTGAAGTACAAACAGAGGGGAGCGCCCAGTAAGTTTAAACTTTCCCATCAATGTTGTCAT
ATGATATTTCTTGGCGTGTTTCCCTTCAATTTACTGAAAGGCAAACAGTAATGTTAAGGA
TTCTGTTGTTTTTTTTTACCGTATACGCTTGATTTCGTCAGCCCCTTGGAAGACACGAAA
TGTTGACTATCCGCTTCCAGATCTGGTAAAAGATTGATTTGCGATAATTCCTGTTGTTGT
CATCACGGGTGTTATGGTTTGTTGTAAACTAAAAAAAGAATGAAGGAACAGGACGCAGAT
TCATCTAATCAAGTTCTGTGGGGAGGTCCCCAGTGGTAAGTGAATAAATATTCGCTTTAT
GAAGACCTACACCTGGTTTTCTCAATGGATCAGACGATAAGTACAATTTTTGTAGAGCTA
TACTCGAGGACAATCAGACAAAACGAAAGAATATCTTTCG
Chr coordinates Chr XV from 104326-106293
w3c xhtml validator w3c css validator