Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PAP2
Systematic Name YOL115W
Alias TRF4
Strain S288c
Description Non-canonical poly(A) polymerase; involved in nuclear RNA degradation as a component of TRAMP; catalyzes polyadenylation of hypomodified tRNAs, and snoRNA and rRNA precursors; required for mRNA surveillance and maintenance of genome integrity, serving as a link between RNA and DNA metabolism; overlapping but non-redundant functions with Trf5p; relocalizes to cytosol in response to hypoxia
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PAP2 YOL115W
AGCAACTCTTCTCAATCACGGCAGTCTCCTAATCTCCAGAAAGTTTCTCCTAACCATGAA
AATGCGGTTGAATCAAATGCACAAGAGAGCGTGCCGACATTTGAGGAGGAACAGTATGAG
ACTAAAACAGGATTGAAACGGAAACGAATAGTCTGCACAAGACCCTTCGAATTTATCAAG
TCACCACACTCTGTGATGGAGGTTTGGAAGGAGTATACAGAAGGTGTTAACGGGCAGCCT
TCTATAAGGAAAATGGAAGCTCTTTATCAAACGGCATGGAGGCGAGATCCAGCAGTAAAT
AAAAGATATTCGAGAAGAAAGGTTCTTTGGAAAGCCATTCAAACTGGCCTTAATCGTGGG
TATTCATTAAACTATGTTGTTGAAATATTAGAAAACTCAAGATATGTTAATGATAAACAG
AAGGTTAAACAACCTATTGGTTGGTTATGCCACAGTTCTCATATTCCAGAGACTTTGAAG
TGACATTTGCTTCTTGTGTATTCACCTTTATCCCAAATTAGCCCTTGTAACACTTATGCT
TTTCTTAATAAATTAATAATTGGACTTTCCTTTAAAGTGGGTTGTATCTGTAACAATAAT
CTCTAATAATATCCTATAAAACTCAGAAGTCAGCCAACAACAATTGTATACGTATACATA
TCTATATAATATGCCTTGTACTTTACGCTCTTGAATTTAGAATAGCTGAACACCTAACTG
AATTTAAGTAAAGGATCCCAAGCGTGAGATATTTAGGTTTACTCAGTTTTCTTATCTTGC
CTTTTGATTATCACGTTGAGTGTCGAAGAAACCTGTATTCATCCTCGGCTTCTTGTATAT
GATTCTAAAATAATGTGTGAAAAAAAAAATAAAATAAAAAAAAGAGGAAAATAATATAGA
ATAACTATTAAGTTTCATTAAAAAAAAACCATTTGAATATACGACCAAAAACGTTACGCT
TTCATAAAGTGTGAATAAGCAAGGGAACTATACTTGAAAT
Chr coordinates Chr XV from 101475-103229
w3c xhtml validator w3c css validator