Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL18A
Systematic Name YOL120C
Alias eL18, L18A, L18e, RP28A
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, identical to Rpl18Bp and has similarity to rat L18 ribosomal protein; intron of RPL18A pre-mRNA forms stem-loop structures that are a target for Rnt1p cleavage leading to degradation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL18A YOL120C
TGCAGAAAGTTCCCTAACTTCATGCGCTACATATTTAGCATCTTATTCTATGACAAGAGG
AAACACAGAAAATGTTGCTTATACCATGATCACTGCTTCGAATGCTGTTGGTATACTTGG
AAGGTATATACCAGGCTATTTTGCGGATAAGTTCATCGGGAGATTCAATGTAGAAATTAT
CACCATTTCAATGGCTGCCTTATTTAATTTTGTCATGTGGCTGCCATTTGGCGGTAATAC
AAAGGTACTTTGGGCGTACGTTTGTTTGTGGGGGTTTTCGACGGGTTCTATCCTATCACT
GACACCCGTTTGCATCGGGCAGATATCTAAAACTACTGATTTTGGTAAACGTTATGCAAC
GGTATATCTATTGCAAGCGTTGGTAACGATTCCGGTTTTACCTATCGGCGGTACCTTAAT
CGGTAAAGGTACAGTTGCAAATTATAACCATTTTATAATATTCAATTCAGCGTTAATGGC
GGCAGGTGCGGCATGTTATATAATATCAAGGCATATTTGCGTTGGTGCGAAGCTTTGTAA
GTTTTAAGGTCAGCGTTCAGAAGCGTTCCAATAGGGGGGGGGGGGGGTATTTCGTTGATA
CCTATGTGGCTATATAGTCGATCTAGCTTTAAAAACTCTAAAGCATATATACATATATAC
ATATTTAGCGTCATGCCAAGAATTCATAATTTCGAAGACTGTTTTCTACATATCTTATGT
GGTGTACGGATATGAATTTTTTTACCGAAGACAATAATGCATGGGTGTTAATTCTATTTT
TTTTTTTTTCTAATTCAGAATGAAATTTTTTTCTTGCTGGAGATTACAGTGGAAATTTCG
CTCCAACACACGCACTCTCTCTGACTTGGTGCTGCCGTGAGATTCTGGTTCCTCAAGGAA
TATTGTATGAGATAATTTAAAACAAATTGAGTTGAAGATTCATCAATTCTGCCATTTTGG
ATCCATCACAAGAAGAGATCATCAAGCTTACGGATTCACA
Chr coordinates Chr XV from 93843-93395,94402-94291
w3c xhtml validator w3c css validator