Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PFK27
Systematic Name YOL136C
Alias 6-phosphofructo-2-kinase, PFK-2
Strain S288c
Description 6-phosphofructo-2-kinase, catalyzes synthesis of fructose-2,6-bisphosphate; inhibited by phosphoenolpyruvate and sn-glycerol 3-phosphate, expression induced by glucose and sucrose, transcriptional regulation involves protein kinase A
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PFK27 YOL136C
CACCCAACTTTATAAGAAATCCACAGAAAACGAAAGCACAAATTATCAATACAAAATCCA
AGAGCTACGCAAACTATTGAAATCCCTCCTGCTAAATTACTTGGAACTCATCGGCGTATT
GAGCATAAATCCGGATATGTATGAGCGCAAAGTGGAGAACATAAGGACCATTCTTGTCAA
TATTCACCACCTACTTAATGAGTACAGACCCCATCAGTCCCGAGAGTCCCTTATTATGCT
ATTGGAAGAACAATTAGAATACAAGCGCGGGGAAATTCGCGAGATCGAGCAAGTATGCAA
ACAGGTACACGACAAACTCACCAGCATACAGGACACCTTAAGAACCGGATCACAATCTCC
TCCATCGTCGTCCCAATGACCACACTATTATAAATCATTTGTGTAACTATATACATTTTC
AACTACCGTATAGCGTATAGTAGGCACGTGGTAGTCCACCCGTACACCTCCCTCGGAACG
GAAAAATACGAACTATAGCTTATCGGAATATATACCAAAAATTAATTGACGTATTTCCGA
GATTCCAGGCACAAGTGCCCCACCTTTTCACAGAAATCGCGCACAGATGAGTCTGCAACG
GAAATTGTTTTCCTTTTTTTTCTTTTTCTTCTCTGGGCATCTGAATCGATTGATAATGAA
AAAAAAGTAGAAAAAGTAAATTGGATTACTCGGTTTTTCGTGTGGAAGATTGGCTTATAT
AAAAGAAGACGTGCTCTAAACAAAGGTGTTTTCGCTTATTTTGGTGCCACAGCAAACCAA
CTTATTTGCTTTTTTAGAGGGTGTTAAAAAGTCTGATACGCTCATATACGAGTAACACTA
AACCGGAAATACTAGGAGAGCCCAGTACTTATACTTCTTATTTGGCTTCAAGTTCCACTG
CCCTCGAAACAAATTACCTTACGCGATTTTTAATATTTTAGATATAAGGAAAAGGAAGAA
AAGGGATAACGAACGCGTTTTTTCCGCTGGAAGTTTGAAA
Chr coordinates Chr XV from 68754-67561
w3c xhtml validator w3c css validator