Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GRE2
Systematic Name YOL151W
Strain S288c
Description 3-methylbutanal reductase and NADPH-dependent methylglyoxal reductase (D-lactaldehyde dehydrogenase); stress induced (osmotic, ionic, oxidative, heat shock and heavy metals); regulated by the HOG pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GRE2 YOL151W
AATATGTAATAGTTATGCACTTTAATTCTTTTGTTCATCTAGAAGACAATACAACGCATT
TCTTGGCTAACCATCTTACAGCCTTGAGGGTAAAGGGCGGGCAAACGAACAAAAGTACAA
AATTTCCATCCTTGTTTGATAATCATTTCCTCGGACCAGATAAGAATGAGCAGCCGAAAT
AAACGGTAACGTGATTAAAACCGCTAGAAGAGTGTTTTTGTAAGGATGAAAACCTCAGTG
AGAAAGTTGACAATATAAACATTATCAGCTTTTCTCGCCCTCTTTTGCACTTCCTGCAAC
ATTACTTGTTCTGCAGCTTGTTTCTTCCAAATATATCCATGCTCTCGGTGTGCCACTTCT
GGGGTTTCTCACCAATAACAGAACATATCCAGTATAATACATACACCATATTCACACCCT
ATTTCATATCATTAACCTCTTCATTTTTAAATGCCAGCGATTACTTTGACTTCTAATCAA
GAACGCGAAAAAAAATTACCGCGTGAACTATGTCATATTTGCGATTTTAGGTACAATAAA
TATTATCATTATTATATTATGTTTGCATGTAGGTTCTACAAATACATTGTTGTACGCTAT
AGTTTCCTTTCAAAACTAGAAAGAATTCGTAACAAAATAATCTCCAATATTTTATAGCAC
CTTATTAATATCAATGCTGCAATACCTTCTCATTTCAACAATTGGCCCTCACCTCTTTTG
TACAAAAAACGTCGCCATTGATAAAATAAGTAAGAAGCATATAATTGGAATGTCCATTAC
GTAAAAGAAAAAAAATCATGTGTACATATTACGTAATAGAATACGGAATTTTCTCGCGGA
AGTAGATCTTCCGTGGAAAAAAAGGAAAAAGTCCGATCAATATTGAAAAAGGGATCCTTA
GTTTCCCAACTATATAAGGAGGAAAAGTCTATCTCTGTAGCGTTGATATAACGTGTACGA
TTTTCAAACAAACAGATAGCAGTATCACACGCCCGTAAAT
Chr coordinates Chr XV from 43694-44722
w3c xhtml validator w3c css validator