Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HPF1
Systematic Name YOL155C
Alias mannoprotein
Strain S288c
Description Haze-protective mannoprotein that reduces the particle size of aggregated proteins in white wines
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HPF1 YOL155C
ATGTGACCGTGCCTTTTTTGCACTTTTAGAGAAACAGTGTTAAGAACTGTAATAACTGTT
CAATTCTAAGCACTCAAACCGTGCTTGTACATATGCTTCAATGGCCTGCTCGATAGACCG
ATCACGTTTAATTTTTCTTTAATTTTGCCAAGGGAACGTTCTTTTCGTAGGCACCGCAAT
TTATTTCTAATGGATAAGTTCTGAATTTTGCTATGAATTAGTTAGTAGGGCCTACTAAAA
TGGCGTGGTATTTTTAAAGGGCCTTTACCAGCCACTCCTCAACAGAAAACCGTGCTCGCG
TTGCAGAAATACGAGGTAGACACGCGCCTTAGGAACATAAAAATAAATATCTCGCGCTCA
CGGAAGGCAACCACTAACTCCTTTTCATCGAAAAGTGAGGTGTAGCTTACTAAAGCATTC
CTCTTTATCCAAGTCGTATATTTTTCTTTATACTGCTAGTTCATTCTGAGCGGAGATTCC
TGGCTAACTCTCCAATTGGAAATAAGGTAATAATGACTTTTCATGACGAATTGGGTGAAA
ATGCTTGGTGCTAGGCCCTGTGTTGTGGCTTTTTTCGGTAATAGTTTAATTTTCCAAAAA
GGTTCCTGTGACTATCTTATCAAAGTAGCTTAGACCACGTCCTGCACGGTTTTGCAGACT
GCTTAGGGGGTCTCTTGTTGTTATTAGCAGCGGAATATCTTTGTTTACTCATTAAAATGC
CCCCCCGTTCGTTGCAAGGAACGCGCGCGCACAGAACTTGCGGATGCTTCCGCAGAAGTG
CCCGTAGGAGATTTAAGCTAGCCCAGCGGTTAATCTACGCAGTTGCGTATTCGGAGTCCG
CTCACACTTGCAAAAAGCATATAAAAAGCTTCATATTCATCTCATTAGTATCGGTTCTGC
CATCCCATTATCTTAGGTTTATGCCTTTTCTGGTTCTCAAGTCAGTAACAACAAATACCC
ATCGTTGATTCTTTTTGGTAAGATCTCGCCTGTCAAAGAG
Chr coordinates Chr XV from 31606-28703
w3c xhtml validator w3c css validator