Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIR4
Systematic Name YOR009W
Strain S288c
Description Cell wall mannoprotein of the Srp1p/Tip1p family of serine-alanine-rich proteins; expressed under anaerobic conditions and required for anaerobic growth; transcription is also induced by cold shock
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIR4 YOR009W
GAAGTAGACACGATAAAGTTCTTGAAGAAAGATTGTGGATGGGTTTGCTGAAGCTTAGAA
CTAAGAAAAGAAACAAGCACGCGCAAGAAAACCGCTACGGCTAACTTCTAAGGTGAGGAT
ATTGTGATTGTTTATGCCTCATATTTTGCGTTTTTATATGTTCTTCCTTCATACGGCGTG
CAAATTATCCGCCGGCGAACAGGGTGCTATTCTAAAAGGAACTTTGAAACTGTAAACGCG
GTGTACTGAAGGGGTCATCTGAACGAACAATATTTTATGCTTTTGTTAGCCAAACGGTAC
TGATAAGGGACTGTGAAAAAAAAAAGACAATGTATGGGGTTCACGGTTTCCCAGATTCGT
GTGTGTGTAATAATTCGTTTACGGCGCACGACAGACACTTCAGGAAATTTAAAGATCAGA
ATAGGCATACACTCCGCGCAAGGAAAACAAAAGTTGCTACCGTAACCGGCTCGTACGGGG
AAAGCAAGGTCATCTAGTGCTCACTTACGAACTGGCATAATCGAGTTGTGACTTCCAAAC
TTAACCGTACTCTCACAGCTGATGTGATCCGAAGAAAACCCTGAAGATACAACAATGGCA
ACCAAAGGCAACTTAAAAAGGCAAACGAAGTACTTTTCAACAATAGCTTACACTGAAACT
CGCGGAGAGGCGACGCTGCGCGCGAATTATCAGTAAAAATCTCGTAACAACCCATCTGCC
ACTTTTAGAAGGAATGGAAATTCTCAAAAAATGACGGAAAATAATAGAACAGGGTTCCTA
AACGATGCATTTCTAACAAGTAGGATAGTCCAAAAGGGAGGATGCAAATTCTTTGTTTTC
CACGCAGTAAGATATGATCCCAAGCTTTCGAATATAAAAAGGGAAGGATCGCTAGGACAG
ATCAGTTTTTAGCCCGTTTACTTATCTCGTTCCCTACTCTTGTTCTGATAGAAACCAGCA
ACAAAAACCTATTCACTCGCTTATTAATACCATAAAAAAT
Chr coordinates Chr XV from 344335-345798
w3c xhtml validator w3c css validator