Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AUS1
Systematic Name YOR011W
Strain S288c
Description Plasma membrane sterol transporter of the ATP-binding cassette family; required, along with Pdr11p, for uptake of exogenous sterols and their incorporation into the plasma membrane; activity is stimulated by phosphatidylserine; sterol uptake is required for anaerobic growth because sterol biosynthesis requires oxygen
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AUS1 YOR011W
ATTTCAGGAAGCGATCAAAAAGAAAGCAATGTTATTCAACATAACTTTATTCATACTGTA
GTAACAATAACTTCATATCAATTAGGATTCACTGTTCATTGACTTATCACTACAATATGG
AGGAAACGTTGCGTAATCGTTGTCGCTATAGATATTGTCCCTCCCTTCCTCTGTGATAGT
TCTTCTTTATATAACTTTCACAAAAGCTTCTGCCCTCATAGTTGCCCTCAATAAACGAAA
GGCCAGATGCATACAGGTGCAGTAGTACATCCAAAGAAACATAGGGGCAAAAACCGTGTT
CTAATATTAGACTGCATATATCCCCTTGTCATTAGCTTAAATCATATAGAGTAATATGTA
CATACAGGTTATTTTATTTGTAGCTTTCCTCCTCTTTATGGAGCAAAGTAAGCCATACGA
ACGGTTTACAATAGAGAGCGTCGTTTGCTTACGTGATTGTCATGTGCCTTCGTAGGCAAA
GGGGATTGCACACCTTTTTACTAAACAATAGAAAAGTGAGAATTCTCTTATAGGCACTGC
TGCTCCTCGTTTCTTTTTACGCGCTGTCGTTCCAGGTCCTTTTTTCGATTAACTACGGTA
GTTTCAAAGAGAGTGCCTGAAGATCACTCCATATACAGGCTAGATGAACTGTAAACGAGC
TCATCAGCAGCGTCCCTTTCAGTGTCACTACAGCCACAGCAGCTTACCTCCTGTACGATG
TGACAGAGCAAAACACAAATGTGTGTCCTTTCTACTCTTATTTTCCAACTCGAATATAAA
GACGGTGCCTTTGCCTTATTTCTAAGGCACTGAACAGTTCTAAAAGTAAAGTTTTCCCTA
GCCTTAGTACCGTTTCTGTGAAGCAGTTATTGAATAGTTATTGGACATAAAAATCCATAT
TGAAAAAAAAAAAAACATACTTGAGAAGGCATTAGCTGAATAGTAAAGACTGCTGTAATT
CATCTCTCAGTCCTTGCAGTCTGCTTTTTCTGGAATTAAT
Chr coordinates Chr XV from 349679-353863
w3c xhtml validator w3c css validator