Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YOR019W
Systematic Name YOR019W
Strain S288c
Description Protein of unknown function that may interact with ribosomes, based on co-purification experiments
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YOR019W YOR019W
GCTTCTCATAGATTTTGTTAAGTGGTCTTACTCGGTTTTATGGCTTGAAGGTTAACATAA
TTATGAAAACTTATTGATATCCTCCCCACCCCTAACGTTTTAAAAATGATCTCGTCCAAT
ATGTTTGAGGTGAATAATATCGGACCAGTTCTTGTTTTTAAAAGATAAGAATTGCTCATA
TTTCCCATACTTGTTGGAAAATTTCTCTCAACAATTGTATGAAGGCAAAATCCCTCAATT
GAAACATTAAAATAGTGATTAGAAAAACAGGATTAATCAGTTATACGAACGTATTTTTGA
GAGAATATAATGAGAATACAATGAGCTTCAGAAGATCTGTTTTTCTTTACTTGGCACTTC
TTCCTCAACAATTATTGGCACTACAAAATTTTCTAATTAAATGTTAAAGATCCCACAGAC
ATCATTCGTATATATCCTCCCATTTTATACGGTTAGCCAACTTTGCGATCCTACGGAAAT
TGCTATTTTTATAGTCAACTCATTGATCTCGAGCACAGCTGCTCTTTTCTCTCAATGAAT
TACGTTATATGTTAATCACACAAGCATCAGTTTTTCATCGCAAAAGAAAATATTTAGAGT
TCTTGCAATTCAGATGTACCTCAATTAATAACTCAATCACCTCCTATGTTCTTGCTGGTA
GTACTGCTTTTGTCTTAATTACTGCTGAATCAGCCTTCTAGAAGACCGTTCTGTTTCAGC
CGCTCGCCCCTTTTCAAAGCTTGCGCGGCTGAGTTTTATGAGGGGCGGCTTTTTTGTGAA
TGGCAATCTACCATTATTAGTAGCAATATGATTTGCAGATAGATACATATATATCCTTCT
GGGTTCATGTCTCGTTACCATCCACACTAATGCATAGGACCAGAAAGAAAGGACATCGAA
TCCAACACGTATTAAAATAAGGACTCCTCATTAAAAAGGCTTTTAATATTCAACTTGCTA
TAGATCACGCACCCTTTTGGCAAGTCAACCTTAAATTATT
Chr coordinates Chr XV from 368127-370319
w3c xhtml validator w3c css validator