Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MCO10
Systematic Name YOR020W-A
Strain S288c
Description Putative protein of unknown function, conserved in A. gossypii; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MCO10 YOR020W-A
CCGGGCCTACGGCAACAACTTCAGCTTGGTTTAACTTCTCCACGTTCTTTTCAGGTAAAT
ACAACCCGGATGCTGTCTTTGCTTGTGCCTTGATTCTTTGGACAAGGACACGGTCCATCA
ATGGAACGATAGATTTAGCAGACTTCAAAAGGGTGGACATTCTTTTTTTTCTGTAGATTC
AATATATTTTCGATCAATGGCTTCTATCAGAAATTATTTTAAACCTAGCACATAATAAGT
TTGTACTGTATAAGCGTTTTGACTAATTTTATACATAATCAAGCTTCTTTTTCCCATTCC
TTCAAGATTCTAGAAATTTCTATCATTGATGACGGGCATTACCCCGTTAATGACCTTCAC
ACGAATGAGAATTGGGCGGCTAATGAGAGAACTTCGAGAGGTGCAATAAGTGAGAAATAA
CAACTTTAGAACTCATTATGATTGCTTCCAATACCTAATCCTACGTATGTACTAAATTAA
AAAGACAGACATGCATTATTGAATATTGACATTTTGAGAGTAACTTTTTATTATGAGTGG
CATAATAAGATAATCGACGCAAGCCACAATTTATACAATAAAAAATGCTACCATCGCTGC
TACATATGAACGAAAATAATACAACTATCGTTACGGCCTTTGCTGAACCGTAATAAAATA
AAATTCCTTGTTACATTTTTTTAGCCAGCTGCCTCAGAAAGAGGCGTTTACTATTTAATG
GAGAAAGAAAGCAAAGAAAAATAAAAGGTATTTTCTTTACGGAAAGCCTTCGAGCAATCC
AGGAGAAAGTGGACCTTTTTTTCCCAATGAAGAGATCATAGGAGTATGGATTGAAAATAT
AATAGAACTTCGGGTAACGAGGTGTAATTTCACAGTCCATAATACAGAGCTAACGGTTTA
AGGGTAAATAGTTATCTAAGTCAAGTTTTGAAGGAACAAGTAAGAAAGGTCGCTACTGTT
TCTAAACATAAGATATACAAAAATAAATATAGCTATCTCA
Chr coordinates Chr XV from 371685-371957
w3c xhtml validator w3c css validator