Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BUB3
Systematic Name YOR026W
Alias PAC9
Strain S288c
Description Kinetochore checkpoint WD40 repeat protein; localizes to kinetochores during prophase and metaphase, delays anaphase in the presence of unattached kinetochores; forms complexes with Mad1p-Bub1p and with Cdc20p, binds Mad2p and Mad3p; functions at kinetochore to activate APC/C-Cdc20p for normal mitotic progression
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BUB3 YOR026W
GCGACCTGAAAACTCTTTCGTGTACAAAGTGCTTCCAGACTTTTCCCTGGAGCAGGTACT
GGTCTCGTTGTCTAAGAAGAGGTGAGTTACCATTGTGTCCGGATTGCGAAGCACTTATCA
ACAAGAGATTGAATGAAGGAAAGCGAACTCTTGGTTCTAATGTGGGTATTCTAAGACCTA
ATATCGTCCTGTATGGTGAAAACCATCCATCCTGTGAAATTATTACGCAAGGCCTAAATC
TTGACATAATTAAAGGCAATCCTGATTTTTTGATCATCATGGGTACAAGTTTGAAAGTTG
ATGGTGTGAAACAACTGGTAAAAAAATTAAGTAAGAAAATTCACGATCGTGGCGGCCTGA
TCATTCTCGTAAACAAGACACCCATTGGCGAATCCTCTTGGCACGGCATTATAGACTACC
AAATCCACTCAGATTGTGATAATTGGGTCACATTTCTTGAATCCCAAATACCAGATTTCT
TCAAGACGCAAGATCAAATTAAGAAGTTAAGACAGTTAAAAAGGGAGGCGAGCGACTTGA
GAAAGCAAATGAAGGCCCAAAAAGACTCAATCGGAACCCCCCCAACAACCCCTCTACGAA
CTGCCCAGGGGATTGATATTCAAGGAAACAACGAATTGAATACAAAAATAAAGTCGTTAA
ACACAGTTAAGAGAAAAATACTGTCACCAGAAAACTCCAGTGAGGAAGACGAAGAGGAAA
ACTTGGATACAAGAAAACGCGCTAAGATACGACCAACTTTCGGTGACAACCAAGCCTCAT
AAACTTAACTATTAAAATTGAGTTAACGATAAATAATCGAGGCAGACACCCCTTTGCATA
ATATATCATCCGTTTAATTTATCTTCCATTTATATACTCATACATATACCAACGGAGATC
TGCATGTCCGAGAATACAAAAAATAGTGAACGAAAAAAATATCACATCGCGAAAGAAAAG
CTATCTGATATCTGCAACACGAAAACACAACAGTCGCGGC
Chr coordinates Chr XV from 379781-380806
w3c xhtml validator w3c css validator