Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PEP12
Systematic Name YOR036W
Alias VPL6, VPS6, VPT13
Strain S288c
Description Target membrane receptor (t-SNARE) for vesicular intermediates traveling between the Golgi apparatus and the vacuole; controls entry of biosynthetic, endocytic, and retrograde traffic into the prevacuolar compartment; syntaxin
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEP12 YOR036W
TACTTAGTCCTTTGGTCAAAAATATTTCAGAACAAAGTGTTGTCAATGAAGGATATAATT
CTGATAGGGTTTTGACTATGATGGACAATGGATCATTTCCAACGTCTATTTCTGCCTCCA
CAATTAAGCTACTCATGAAATCGACCACTGCTTTATCAAAGTCTTTTTGGAAGCTTGATT
GTAATTCAGCAAAAATTATAAGCATCATCGATTTTACTTCATCTTCGCTTATGCGCAAAA
TAAGTTCCTTCACTAAAAATCGCACCTCCTTGAAATTGTACTTGAACTTATTCAATAGTT
GTAGAATTATGCTCAGTAAATACGTGACGTGGGTGTCCTCGCCATAGTGTATCCTAATTT
GCAGCTCATTTAACAATGCAATTGTTGCGTCTTTATTGGAAAAGCAACCAACGAAAACGT
GGATGGATGATCTTGATAATATTTCAAATAAATTGAGTGCGAAGGGAATATCATTCTGTA
TAAGTTTAGATAAATGTACGCGGGACTCAGAATGGTCTTGGTAAGACCTGGTCAATATTT
CTTCGATTTTCTGACGATCTTTAAGGGCTTCACTATTCGTTAAATCAGCCGGCATTTTCC
CAGATTCAGATTTTTGCCTTAGCTGGAAAATTGTATTTATAGCATCATTGTATTTTTGGA
CATCAGGGGTGGATTTCAAAGTCTTGTCAAATGCAGCGCAGAGGCTATCAATAGTAGAGC
TATCGATTGGATCATTCCCTTTCTCACACAGTGGCATCGTGATTCTAATTTTTTAGTAAT
CTTTTCATGTGAGTAGTTTAGATAAAACGTCTTCACTATTAAGTAGAAGATTCGTAATTG
GATTTAAGCCTTCGTGCCTTATCGCGGCTGATAATCATCATGATCGACGATGAACTACTG
CGCCAGAGTATAATCCCCTATAAAACAGGCCTGCTATCACTCCAAAGAGAATGCTTTTAT
AGAAGAATATAACGTAAATTACTACAATAATTGTGTTGAG
Chr coordinates Chr XV from 400348-401214
w3c xhtml validator w3c css validator