Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CKB2
Systematic Name YOR039W
Strain S288c
Description Beta' regulatory subunit of casein kinase 2 (CK2); a Ser/Thr protein kinase with roles in cell growth and proliferation; CK2, comprised of CKA1, CKA2, CKB1 and CKB2, has many substrates including transcription factors and all RNA polymerase
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CKB2 YOR039W
CTGCGTAAGTTTATTTATGAGTTTGTGTGTACCCGTTTTGTTAATTTGATAGACTAAAAT
TGATCTATCTGAAGTCATAACAGTAAAAGTTTGGCCAGTAGGATCTATTATGCCTGTAAT
AGGTTTGCTCGCCTTGTCAATAGTTATTTCAGAGAGTTTATCAAAGGTTTTATGCCGAAA
TAATAGTATCTTATTTTCATTACTTAAAAGAACAAATAAGATACCTAAGTTTATGTCATA
TTTCACATCCGTTATTGTGCTTGGAGATTTACACTCGAACAGAAGCTTACTGTTCATTTT
TTCGACAGAATTGATGTTATTTGTATCTCTACAGAGCCAACCTGAATAACCCCACAGACG
ATGTTCAGATCCAATATACAATGTTTCGAGATCACCTGTTATGAAAAAAATATCACCGGT
AGTATCCTGATCCACCTGGAAAGAAACTTCTGGCTTTAAATCCTTAATCATAACCCTATC
GAATGCAGTATCGACTAGTTGTTGTTGTCTCCACGCCATCACGTGACCCCCACTGCCTGC
CAATATGATATAGGGACCAAGGGCAGCTAAGGCATTCACTTGTTCATTATGAATATCCAA
AGGATACTTTAATAATCTCATTGTTCCGGATTGTGTAGGAACTCCTTTGCTGCGTGGCGT
ATTCCTCTGTATGGACGATTTAGCACTTTTTGTATATTGTTTTATGAAGACTTCATAATT
CTAGCCGAATTAACTGATATTTTTTTCGCGCTTTTTTTTGTCGACCTTCCAGGAAGAAAA
AATATGAAAGCGAATAAATGGAGGTGTATTGGCAATCCTTTATCAAATGAAAACAAGCAC
CAAATAGAATAAGTAAATCACATTCTTAAAGAAGTTGGTCATTCCAGATACGTGGAATTT
TCCTGCTGTATTTTTTCATCAATCTTTTACTTGAGAAATACTAGCTTTTTTCAAATTATT
CAAGATTAAGGGACTTAGAGAACTGATAGAAAAGCAGATC
Chr coordinates Chr XV from 405768-406544
w3c xhtml validator w3c css validator