Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name WHI2
Systematic Name YOR043W
Strain S288c
Description Negative regulator of TORC1 in response to limiting leucine; suppresses TORC1 activity with binding partners Psr1p/Psr2p, acting in parallel with SEACIT; regulates cell cycle arrest in stationary phase; inhibits Ras-cAMP-PKA regulation of apoptosis during nutrient depletion; required with Psr1p for activation of the general stress response; role in rapamycin-induced mitophagy; localizes to the cell periphery; human tumor suppressor and Whi2-like protein KCTD11 functionally complements the null
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>WHI2 YOR043W
TAGGTCTTTTACGGCACCCGTTCAGACACTTTGACACTTCAAAGTATATGCATCAGCACA
CTTCTGACCATTCTACGTATTGTAACAGCAACATGAGTTCTTTAAAACTCCAATTGACAT
TTTCGTAATGTGTTTTGCATATCATCTAAATTTCAATGACAGATTTAAAAAGTCAAGTAA
TTAAAAATTTTCATAAGCGTGCTTTTTTATAGTGCGAAGAACGGCAAAGGCAACCTTAAG
AAAAAAAAATGATAGGTTACGTGCTATATCCGGAAAATAAAGAAAGATGAGTAAGAGTTA
AAGAAAGAATTCAACCAACCTGATGGGTGTATGAAAATCCCGATTTTATATCGACAGCGC
TAGCATGCATGAACAGTGTTTTGACGGTCAAGAAAAAACATAACCTCTGCATAATGTACT
TACTTATCAAAACGTTGCAAATCTTGTATGTAAGAGGTGTTTGGGTGTTTTTTCCAAACG
ACCCGAAGGAGGGCAATTCAAAATAAAAAAAGCAAATTTTATCAGGAAGAGAAGATTTTA
GTCAGAACGGGCCATGTTCAATGGCCAATTTCTTATGCTCTAGAGTAATAATTACTAAGG
AGGAAAGTAAGACAAAAAACGGTCTATCGTTGTTTTAAGTTTACAGCATAGGCATAGTGA
TAGAGTGTGAGAGAGTCTCTAACTCGGCGTCAGTTTAGAGTCATTTTTTTCTTTTCTCCC
CCCAAAGGTCATAAGAAGATAAGGATCCAAATTTAGAAGACAAAAAAAGTTTTGTTAGAA
CGTTTATCCCATTAAAAATAAGGGAAAAGAGAAACAACGTTATTTAGTGATTTTTTTAAT
TGAGAAGCATTTTCTCCAGTGATAATTTAATTGTTTTTTTATTCGGAAAAGAACAGAAAG
CGCAAGAAGACAACTCCTTCACACTTAGGCTATTAATTTTCCCGCCTCCCCATTAATTGA
TAAAGATAAAGGTTGTCTGAGCTTACACTTATTATAAACA
Chr coordinates Chr XV from 410870-412330
w3c xhtml validator w3c css validator