Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name WHI2
Systematic Name YOR043W
Strain S288c
Description Protein required, with binding partner Psr1p, for full activation of the general stress response, possibly through Msn2p dephosphorylation; regulates growth during the diauxic shift; negative regulator of G1 cyclin expression
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>WHI2 YOR043W
ATGGACGATATAATCACGCAAGTTTCTCCAGATAATGCAGAGTCCGCTCCGATTCTACAA
GAACAGCAACAGCAACAGAACTCACAGTACGAAGGTAACGAGGAGGATTATGGTGATTCA
TTGATTCATTTGAATATTCAAGAAAACCATTATTTCATTACGAGGGACCAGTTGATGTCT
CTACCTGAATCCCTATTACTGTGTTTATTTCCCTCAGGTGTTTTTTTGGACCGTTGTGGT
CAGGTCATTACTAATTTGACCAGAGACGATGAGGTCTACATTGTTAATTTCCCTCCTGAT
TGTTTTGAGTACATCATGGAGATATATACAAAAGCGCATGATGATTTGTATAATCATCCT
GTGGAGAAATTTTTTGACAGACCATCAAGTAGCTTTGTTTCGAATGCAAAGGGATTTTTT
GGACTGAGTAGCAATAATTCAATTTCGAGCAACAATGAGCAGGATATTTTACATCAAAAG
CCCGCTATTATTGTTTTGAGAGAAGACTTGGATTATTATTGTGTACCTCAGGAGGAATTT
CAGTTTGATTCCACTAATGAAGAAAATAATGAGGATTTATTGCGACATTTTATGGCTCAA
GTGAAAATGGCTGCTGGCAGTTATTTAACTTCAAAAACATCGATTTTCCAAGGTTTGTAT
TCTTCGAATAGACTAAAGCAACAACAGCAACAACAGAAAATTGAAAAGGGGTCCAATTCT
TCTTCAAATACTAAATCTACTTCGAAAAAATTGGGACCTGCTGAACAACATTTAATGGAT
ATGTTGTGCTCCTCCGGATTCACCAAGGAAACTTGTTGGGGTAACAGAACTCAAGAAACT
GGCAAAACGGTTATAAGTTCACTGTCTCTTTGCCGATTGGCTAACGAGACAACTGAAGGA
TTTAGGCAAAAATTTAACGAGGCTAAGGCTAAGTGGGAGGCAGAGCACAAACCTTCTCAA
GACAACTTCATCACCCCAATGCAATCTAACATATCGATTAACTCTTTATCTGCAAGTAAA
TCTAACAGTACCATTTCTACAGCAAGGAATTTAACAAGCGGAAGTACAGCACCTGCTACA
GCACGTGATAAGAGAAAATCAAGGCTGTCGAAACTAGCAGATAACGTTCGTTCGCACTCT
TCCTCGAGACATAGTTCGCAGACCAGAAGTAAACCTCCGGAGTTGCCCAAATTGTATGAT
CTAGTGCCAAAACCTAATATCAACGCTAAGCTACTATTATTTTGGAGAAAACCTGCTCGT
AAATGTTGGTGGGGTGAAGAAGACATAGAGCTAGAAGTGGAAGTCTTCGGCTCTTGGAAA
GATGAATCAAAGAAAATCATTGAATTGATCTTGCCAACAAACGTTGATCCTGAAGCAGAA
CTACATAAAATCATTGTACCCGTCCGATTACATATTCGTAGAGTTTGGACTTTAGAGTTG
AGCGTTATTGGGGTGCAGTGA
Promoter Sequence
Download FASTA
>WHI2 YOR043W
TAGGTCTTTTACGGCACCCGTTCAGACACTTTGACACTTCAAAGTATATGCATCAGCACA
CTTCTGACCATTCTACGTATTGTAACAGCAACATGAGTTCTTTAAAACTCCAATTGACAT
TTTCGTAATGTGTTTTGCATATCATCTAAATTTCAATGACAGATTTAAAAAGTCAAGTAA
TTAAAAATTTTCATAAGCGTGCTTTTTTATAGTGCGAAGAACGGCAAAGGCAACCTTAAG
AAAAAAAAATGATAGGTTACGTGCTATATCCGGAAAATAAAGAAAGATGAGTAAGAGTTA
AAGAAAGAATTCAACCAACCTGATGGGTGTATGAAAATCCCGATTTTATATCGACAGCGC
TAGCATGCATGAACAGTGTTTTGACGGTCAAGAAAAAACATAACCTCTGCATAATGTACT
TACTTATCAAAACGTTGCAAATCTTGTATGTAAGAGGTGTTTGGGTGTTTTTTCCAAACG
ACCCGAAGGAGGGCAATTCAAAATAAAAAAAGCAAATTTTATCAGGAAGAGAAGATTTTA
GTCAGAACGGGCCATGTTCAATGGCCAATTTCTTATGCTCTAGAGTAATAATTACTAAGG
AGGAAAGTAAGACAAAAAACGGTCTATCGTTGTTTTAAGTTTACAGCATAGGCATAGTGA
TAGAGTGTGAGAGAGTCTCTAACTCGGCGTCAGTTTAGAGTCATTTTTTTCTTTTCTCCC
CCCAAAGGTCATAAGAAGATAAGGATCCAAATTTAGAAGACAAAAAAAGTTTTGTTAGAA
CGTTTATCCCATTAAAAATAAGGGAAAAGAGAAACAACGTTATTTAGTGATTTTTTTAAT
TGAGAAGCATTTTCTCCAGTGATAATTTAATTGTTTTTTTATTCGGAAAAGAACAGAAAG
CGCAAGAAGACAACTCCTTCACACTTAGGCTATTAATTTTCCCGCCTCCCCATTAATTGA
TAAAGATAAAGGTTGTCTGAGCTTACACTTATTATAAACA
Chr coordinates Chr XV from 410870-412330
w3c xhtml validator w3c css validator