Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name WHI2
Systematic Name YOR043W
Strain S288c
Description Negative regulator of TORC1 in response to limiting leucine; suppresses TORC1 activity with binding partners Psr1p/Psr2p, acting in parallel with SEACIT; regulates cell cycle arrest in stationary phase; inhibits Ras-cAMP-PKA regulation of apoptosis during nutrient depletion; required with Psr1p for activation of the general stress response; role in rapamycin-induced mitophagy; localizes to the cell periphery; human tumor suppressor and Whi2-like protein KCTD11 functionally complements the null
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>WHI2 YOR043W
ATGGACGATATAATCACGCAAGTTTCTCCAGATAATGCAGAGTCCGCTCCGATTCTACAA
GAACAGCAACAGCAACAGAACTCACAGTACGAAGGTAACGAGGAGGATTATGGTGATTCA
TTGATTCATTTGAATATTCAAGAAAACCATTATTTCATTACGAGGGACCAGTTGATGTCT
CTACCTGAATCCCTATTACTGTGTTTATTTCCCTCAGGTGTTTTTTTGGACCGTTGTGGT
CAGGTCATTACTAATTTGACCAGAGACGATGAGGTCTACATTGTTAATTTCCCTCCTGAT
TGTTTTGAGTACATCATGGAGATATATACAAAAGCGCATGATGATTTGTATAATCATCCT
GTGGAGAAATTTTTTGACAGACCATCAAGTAGCTTTGTTTCGAATGCAAAGGGATTTTTT
GGACTGAGTAGCAATAATTCAATTTCGAGCAACAATGAGCAGGATATTTTACATCAAAAG
CCCGCTATTATTGTTTTGAGAGAAGACTTGGATTATTATTGTGTACCTCAGGAGGAATTT
CAGTTTGATTCCACTAATGAAGAAAATAATGAGGATTTATTGCGACATTTTATGGCTCAA
GTGAAAATGGCTGCTGGCAGTTATTTAACTTCAAAAACATCGATTTTCCAAGGTTTGTAT
TCTTCGAATAGACTAAAGCAACAACAGCAACAACAGAAAATTGAAAAGGGGTCCAATTCT
TCTTCAAATACTAAATCTACTTCGAAAAAATTGGGACCTGCTGAACAACATTTAATGGAT
ATGTTGTGCTCCTCCGGATTCACCAAGGAAACTTGTTGGGGTAACAGAACTCAAGAAACT
GGCAAAACGGTTATAAGTTCACTGTCTCTTTGCCGATTGGCTAACGAGACAACTGAAGGA
TTTAGGCAAAAATTTAACGAGGCTAAGGCTAAGTGGGAGGCAGAGCACAAACCTTCTCAA
GACAACTTCATCACCCCAATGCAATCTAACATATCGATTAACTCTTTATCTGCAAGTAAA
TCTAACAGTACCATTTCTACAGCAAGGAATTTAACAAGCGGAAGTACAGCACCTGCTACA
GCACGTGATAAGAGAAAATCAAGGCTGTCGAAACTAGCAGATAACGTTCGTTCGCACTCT
TCCTCGAGACATAGTTCGCAGACCAGAAGTAAACCTCCGGAGTTGCCCAAATTGTATGAT
CTAGTGCCAAAACCTAATATCAACGCTAAGCTACTATTATTTTGGAGAAAACCTGCTCGT
AAATGTTGGTGGGGTGAAGAAGACATAGAGCTAGAAGTGGAAGTCTTCGGCTCTTGGAAA
GATGAATCAAAGAAAATCATTGAATTGATCTTGCCAACAAACGTTGATCCTGAAGCAGAA
CTACATAAAATCATTGTACCCGTCCGATTACATATTCGTAGAGTTTGGACTTTAGAGTTG
AGCGTTATTGGGGTGCAGTGA
Promoter Sequence
Download FASTA
>WHI2 YOR043W
TAGGTCTTTTACGGCACCCGTTCAGACACTTTGACACTTCAAAGTATATGCATCAGCACA
CTTCTGACCATTCTACGTATTGTAACAGCAACATGAGTTCTTTAAAACTCCAATTGACAT
TTTCGTAATGTGTTTTGCATATCATCTAAATTTCAATGACAGATTTAAAAAGTCAAGTAA
TTAAAAATTTTCATAAGCGTGCTTTTTTATAGTGCGAAGAACGGCAAAGGCAACCTTAAG
AAAAAAAAATGATAGGTTACGTGCTATATCCGGAAAATAAAGAAAGATGAGTAAGAGTTA
AAGAAAGAATTCAACCAACCTGATGGGTGTATGAAAATCCCGATTTTATATCGACAGCGC
TAGCATGCATGAACAGTGTTTTGACGGTCAAGAAAAAACATAACCTCTGCATAATGTACT
TACTTATCAAAACGTTGCAAATCTTGTATGTAAGAGGTGTTTGGGTGTTTTTTCCAAACG
ACCCGAAGGAGGGCAATTCAAAATAAAAAAAGCAAATTTTATCAGGAAGAGAAGATTTTA
GTCAGAACGGGCCATGTTCAATGGCCAATTTCTTATGCTCTAGAGTAATAATTACTAAGG
AGGAAAGTAAGACAAAAAACGGTCTATCGTTGTTTTAAGTTTACAGCATAGGCATAGTGA
TAGAGTGTGAGAGAGTCTCTAACTCGGCGTCAGTTTAGAGTCATTTTTTTCTTTTCTCCC
CCCAAAGGTCATAAGAAGATAAGGATCCAAATTTAGAAGACAAAAAAAGTTTTGTTAGAA
CGTTTATCCCATTAAAAATAAGGGAAAAGAGAAACAACGTTATTTAGTGATTTTTTTAAT
TGAGAAGCATTTTCTCCAGTGATAATTTAATTGTTTTTTTATTCGGAAAAGAACAGAAAG
CGCAAGAAGACAACTCCTTCACACTTAGGCTATTAATTTTCCCGCCTCCCCATTAATTGA
TAAAGATAAAGGTTGTCTGAGCTTACACTTATTATAAACA
Chr coordinates Chr XV from 410870-412330
w3c xhtml validator w3c css validator