Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name STD1
Systematic Name YOR047C
Alias MSN3, SFS3
Strain S288c
Description Protein involved in control of glucose-regulated gene expression; interacts with kinase Snf1p, glucose sensors Snf3p and Rgt2p, TATA-binding Spt15p; regulator of transcription factor Rgt1p; interactions with Pma1p appear to propagate [GAR+]
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>STD1 YOR047C
TCGGAATAACAAGCAAAGTCGGTATGACAATTCAAGAGCAAATAGGCGTTAGAACTACTC
GTGCGCATTTTATTTTATGGTAAATTTAGGTTTTCGCAAATTTATAAAATCTTCATACAA
TTAAAAAAAAGCTCTTTTAAGATAATAGTGTCTGCTCTTACAAACGACGAACAGTAATAT
TTTATAACAAAAAATGGAACATATTAAGTTAAGAGAAAATCATGCTGAAGCATGAATATA
TGAATATACGTCCTCTTGTAAAATAGCGAAATCCTTGTAAGCCAATAGACCGAACTCTAT
TTTGATTTATACGCTTCGTGTATTTTTTCTTCCAGATCCAGGAGAAAAAGCATGGTCTGT
TCTTCTTTTTTGAAAAGAGAGGCAGTCCACGGCGAAAGTTTCGAATACGGCACTACCTTT
TTTTTCTAAGTTCCTAAACTTAAAATCAAATTTGGTCTTTGGTCTGTTATCATCCAGGGA
TGAATGCAACATATTGGGAAGTTCATGCTATACAACGCCAACCCCTTCGCTCAAGTCACG
AAAGCACATCTTACACTTCCTCCTTGGCCAATATGCAAGCGTCCTCTTCAAAAAATCTTG
CAACAAACAATCGGGTAATGTGGGATGTTGTGGAAAAATGAAATAAAGTTTTCAATAAAT
CCGACTGAGCTAAGCAGGAAAATTTTCGTACGCGGGTTTTTGTCCAATTTTTTCCCTTCC
TTTTGAAAACACGGAAAATCTTTTAGCGAAGGCTGCTCTTAGTTCCATAACGGAAAAATT
CCAGGAGTTATTAAAAGACAGAGTTATAGTTTAGTAAATTTTCTTTTGAGTTAACGAGAG
AGGGACGTTTTCGAACTAAATAGAGGAGAAGAAAGGCTTCAAGAAATATCGTACCGTAGG
AAACCAGTTTAATATATTAGAAGCTCTCATTTACCTATCATTTTCGTTACCATCGCGATT
GTAGGAGGTTTTGCACTACTTAACAGACAAATAAAACGAG
Chr coordinates Chr XV from 417681-416347
w3c xhtml validator w3c css validator