Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VHS3
Systematic Name YOR054C
Alias YOR29-05
Strain S288c
Description Negative regulatory subunit of protein phosphatase 1 Ppz1p and also a subunit of the phosphopantothenoylcysteine decarboxylase (PPCDC; Cab3p, Sis2p, Vhs3p) complex, which catalyzes the third step of coenzyme A biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VHS3 YOR054C
CATTGAATCGACCAGAGAATCAGGTGGCATTGGCGACTGGCGATTTTGCCGTCCAAAATG
TAGCGTTGCAGATGAATCTAAATCTAATGAATTTCATGTCAGGTCTGAAAATCAAGCGAA
TCCGTAATTATATGCTAAGATGCCACGCCTGTTTCAAAATATTTCCTCTACCAAAAGACG
GCAAGCCAAAGCACTTCTGTGCCTCATGCGGTGGACAGGGTACCTTATTAAGATGCGCAG
TTTCCGTTGACTCACGCACGGGGAACGTTACACCGCACTTGAAGTCGAACTTCCAATGGA
ACAATAGAGGAAACAGATATTCTGTAGCCAGCCCCTTATCTAAGAACTCCCAAAAAAGGT
ACGGCAAAAAGGGACACGTACATTCTAAACCACAGGAAAATGTGATTCTCAGAGAAGATC
AAAAGGAGTACGAAAAGGTGATAAAGCAAGAAGAATGGACAAGAAGACACAACGAGAAGA
TTCTAAACAATTGGATTGGTGGCGGTTCTGCGGATAACTATATTTCTCCATTTGCAATTA
CTGGGTTGAAGCAGCATAACGTCCGCATTGGTAAGGGAAGGTACGTCAACAGTTCCAAAA
GGAGAAGTTAGTGTTTTTCATAAATATCTGTGTAGTGTGTACTAGTTGGCAGCTGCCCTT
TTTCTTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACGTGGTTTTTCTATGACGTT
TTCCAAAACAAGCGTGTCATGTGAGCTTTTTTGCCCTTTAACTTTCTGGTTGGAGAGTCC
AAAAGACCGAAAAGGTAAGAAAACGTTTTATTGCTCAGTATGCCCTCCCCTTATGAGATG
AATGGTGTTACAGCACTTTGAAGAGGGCTCGTTTTGAGGACTTTTTGATCAGGATTAATA
CTAGATTGCCAAAAAAAGGATAGCCTTTTATAAGATTACTTTAGTTCAAAGAAGAGACCA
GAAAGAGGAATACTGGCCATAATTATAGTGCAGAGACGCA
Chr coordinates Chr XV from 429857-427833
w3c xhtml validator w3c css validator