Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MSA1
Systematic Name YOR066W
Alias YOR29-17
Strain S288c
Description Activator of G1-specific transcription factors, MBF and SBF; involved in regulation of the timing of G1-specific gene transcription and cell cycle initiation; localization is cell-cycle dependent and regulated by Cdc28p phosphorylation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSA1 YOR066W
TAATAAAAGAAATGAAAAAAAAGAATATTAGTAGAGCATACTGAATTGTTTTCAGAAAGA
GAGTGAAAGGTAACAAAAATTTACCTACTTTTCCTTTTTATTTCTCTGGTTTCGTTTCTT
TTTTTTCGGCCACCCTATTTATTTTTTCACTGCTTGTAAACAACGTCTCACTTCAATAGT
GTCTCCTTCATGTACTGAGATACTGCTGCAAGCGAAATATCACGAATAATAATATAAAAA
AAAAAAAAAAAAAAAAAAAAGATGTTTAAATGTTAACAACCTAACAGCAATAAAAAATAA
AAATAAAGGTAGAAGATTGCAAGAAAGAAACTTTACAATATTTTGTTTGGATGCCCAACA
CCGGCGTCTTGGTGTTCTTCTATAATATTTATTTTATTTATTTTTTATTTATATATGTAC
ATATATATTCCTATTATCTATTAAGAAAGTAAACTTAGTGTAAATCTACCACTGTTCCAA
GGCTTTGGCCATCCACCTTCTCTTTCGTTCCATTAATAATATGACACAATCGTTGAGGAT
GCGAGCGAGACCGTTATGGTCGATCTTTGAAGTCGCCGCGTAACGCGCTAGTATTTTTTC
CTTAAAGAGGCAAACACTTATTTTTCCCTAATAGGAAATCCCTCAAATCGGTTTTTTTCC
ATATTAGTCCCGTTCTATTGTCTGGTTTCATACCTCTAAAATTTCTCTCGCTGTTCCATC
AATTAATACAATCAAGGCACAGCCAGCAAATACTAATAATTCTCTTAATAACTGCTTCCC
CTTTGCAGCACCGATAAGGGATCTTTAAGACGGTCTTGAAAATTTTTCGTTAGTTCATTT
TTCATTCTCGGAAGTTTTTTTAAATTTTGAGAAGAAGAGCTGGTTGCACATTCCAAGGTG
ATTAAAGGGATTTGATTAAGTATATATTCACCAACCTGGGTTGTGTAGTTGAAAAGGGGA
ATAAAAATATCTCAAGAATACTTCGTGAAAAATATTCACT
Chr coordinates Chr XV from 449436-451325
w3c xhtml validator w3c css validator