Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YOR072W
Systematic Name YOR072W
Alias YOR29-23
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on experimental and comparative sequence data; partially overlaps the dubious gene YOR072W-A; diploid deletion strains are methotrexate, paraquat and wortmannin sensitive
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YOR072W	6324646 upstream sequence, from -1000 to -1, size 1000
AACCTGGAGAAATGGAACCGAACCAGTATGAAATCATGTAAACCCAAGCCCATGCTCTTT
TAGAACCAGTAACGGTAGATTTTGTGGAGGTAAACAATTCACCGACACCATGGGCATTCT
TAGTCAAGTAAATCACTATACCCAGCATGGCAAAGCAAGTAGCTACACATGACCAAATTA
AAAGGTAGTTCATATGGTAGGGTTTCATGAAATAGCAGAGCGCGGTGAGGACGTGGAAAA
TAATGAAGCCGACCAACTGCTTGGTGGTCATGGCAACACTTGGGGACAAAGTATTGGGCA
GGTGCAGATAGTGGTGGGACCAGGAATCTAATATCATGTTGATAGATAGACCACCCAACC
AAGCGTTGGAACCATAATTGACAATACTCATCAAAATTCTAATGATGATACCGAAGGCTG
AACCGTAAATGCCAAAAACGAATCTTTGGGCCAAGGTGAAACCGATTTTCCAATCATAAC
CGGGGTAAGAGTTGGCCATAGTGAAAATAATGGTCAAGACATTACCGAGAAGAAACGAAA
CAATGGTCTCTGGGTAACTTAGGCCGACACTTAGTGCAGCAGAACCACTCATCCATGTAC
CTGCTGTAAAGGACACAGCGCCCCAGTACGCCAAATTAGACCAGAACCCCCATGTTTGAT
TTGCAGACTTGATAGGTTGCAAATCAGGGTTCCTCAGAAAATTCACGGCAGTCCTATTTT
TGGCAGGAATTTCTAAATATCTCAAAAACTTAGAGACTATACTACTGAAGCTCATGATGA
TACAGGTGCTGAAGTCCTTTTTTTGATAGTTATAATGGGGATATCAGTACAATAAAGAAT
AATATAAATTCTGCAATAGGAAATAATATAGGTAATTGTTCTTGATAATTCTGGAGTTTA
TAAGATTTTAACTCTATTTATGAGAATAGAGAAGGAAAATTAAAACTACAATAGCGAATG
CAAATTTTTTTCCCCGAAGAACAAATAGCGGTAGCAACAC
Chr coordinates
w3c xhtml validator w3c css validator