Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SGO1
Systematic Name YOR073W
Alias YOR29-24
Strain S288c
Description Component of the spindle checkpoint; involved in sensing lack of tension on mitotic chromosomes; protects centromeric Rec8p at meiosis I; required for accurate chromosomal segregation at meiosis II and for mitotic chromosome stability; recruits condensin to the pericentric region of chromosomes during meiosis; dissociates from pericentromeres when sister kinetochores are under tension
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SGO1 YOR073W
CTACTTCGATTGGGTTATTGAGGAAGAGGATAGTATGCCCGGAATTTTCAAGCATTTACA
TGATTATGGTTTCATTGGGGTGCAAGAAGACCCAGCATGATTAGATTGCTATGTACTCAT
TATATAATATATCTCCGATGAATATATTTCCGAAAGTTTACTGAAGGCGACCTTGGATAA
ACCATAGTTTTACGGCAAATACACCATATCACTATTTTCTTTCTATATAGCTTTGCTAAG
GCTTTTTTTAGTGACCGAGACAAAGAAGAAAATTTTCCATAAATGAAAGACCATTGTTTA
TTCCGAATCAAGTTTTCCGAAGAATTGTTGTATTACACAGTCCAGAGACAGCAGAATCTT
TCAGAAATTTTAATACTGTTGTGACAGCATCTTGTCTATTATTTATTGGATACGCAAAAC
TCATTTTTTTAAAATTTTTTTTATAATTTCCTTTAAATAAAAAGGTTAAAGCTGGGAAAA
ATGCATCTAAATAATAAACTAATGATTTAGTTTCCCTCATTTAAAATATCTAAGAAGGAC
AGAACTTTGTTTGGGGTACTTACCCTTGAGTATTTTTAGCGATTATTCTTGGAGTTCTCA
GCCAGAAGATTAAAAGAATATATGTTACTGAATGCAGTGTGATACTCAAGACTAAGTAGT
CTTAACAACAAGTTAACAAGGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCGACT
TCCTGACTAACAGGAAGACAAAGCATGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCC
CTTTTATTTTTGATTATTTATTTCCTATTGGTCGGGTAACAGATTTTTTTTATTTTTTTC
AAGGCCCTTTTGTTTTGTAAACAAAGAAATTTCACAAAGTGAGCGTCTACTAATATTGAT
AATGCCATTTCCACATTACAACTACTGCTAGGCGCAGGGTTATATTACTTACACACGCAT
ATATATGTTTAATTGGGTATAGAGGGGTTATTGTTTGACC
Chr coordinates Chr XV from 464771-466543
w3c xhtml validator w3c css validator