Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CDC21
Systematic Name YOR074C
Alias CRT9, TMP1, YOR29-25
Strain S288c
Description Thymidylate synthase, required for de novo biosynthesis of pyrimidine deoxyribonucleotides; expression is induced at G1/S
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDC21 YOR074C
CTTTGACTGAAATCTTTTCAGCGACAAATTATGCCTTTCCATTTCGTAATTCTCTAGGAA
TTCAAACTTTTTGAAATATTGTTGAATTTGCAGCCTGCATTCCATGTCAAACTCGTCCTT
TTCCGCATCACTCATATTAAAGTCATCTAAATAGTTTTTTTCAATCTGTTTTATTACCTT
GTTTAATTCGACTAGGAACTTCAATAGTCTTGCACATTCCTTAATAAACGAATCCCTAAA
CATTTCACACGTTTCATTAGAATTCCCGAAGTCCTCTTGTTTCCTTTCAACATGATCATC
TATACCATTTTGCTCATTTCTAGCATCATCGATAACAGCAACATACTTACGGAATATTGG
TGTTAAATCAGACATCATGAGTTAATAAGCTCTTCACTGCTTTTACGGGTGATTTCCCAG
CACCGGGGGAAATGATACTAGACGTATGTGTATGTATTCTAGTTATTCTCATTCATCTGA
GCTCACAAGTTGGGTAGGGTAACGGAGATCTTTCCTTGTTGGCAGTTCTTAATTAAATGT
GCCCTTTTCAGAAAGATACCAGCAAAGGTAGGAATGATTTATCATTACATGACATGTATC
CATATTCCAGGATGGATCATGCGAACAAGCTTCTTTCCCCTCTCGTCTGTAAAGGACGGG
ATTGAGATTCAATTAAAAAATTAGTTTCATTGGAAAAGGCCAATAAAATATGCAAAGGTC
CCGTCATTATACTGCAGCTACCTCAAAGAGATTAGCTTTGTGTCCTCAACGTAGGACCGC
ATTGAACAGGTTGGAAGAGGTGTTGCTTTTTTGACCTTCTTTCTCAAACTTAATATTTGG
TGACGCGTTAAATAGAAAAAATGAAAAAGACCTTAATTGACGCGTTTCCTGAAATATTTA
CTATAGCATAGCTGTAATTGTATTTTCTAAACTTGTAAGTGACTGTGTATATCAAACAAT
AAAGTATCAAGGAGAGAGCTTCATAACAGAACGGTACAGG
Chr coordinates Chr XV from 467589-466675
w3c xhtml validator w3c css validator