Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CDC21
Systematic Name YOR074C
Alias CRT9, TMP1, YOR29-25
Strain S288c
Description Thymidylate synthase; required for de novo biosynthesis of pyrimidine deoxyribonucleotides; expression is induced at G1/S; human homolog TYMSOS can complement yeast cdc21 temperature-sensitive mutant at restrictive temperature
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>CDC21 YOR074C
ATGACTATGGACGGAAAAAACAAAGAAGAAGAGCAATATCTTGATCTATGCAAAAGAATC
ATTGATGAAGGTGAATTTAGGCCAGATAGAACAGGCACTGGTACGTTGAGTCTTTTTGCA
CCACCCCAGCTGCGTTTTAGTTTACGTGATGATACCTTCCCACTACTAACGACCAAGAAG
GTTTTTACTAGAGGTATCATACTTGAACTATTGTGGTTTTTGGCCGGTGATACAGACGCT
AACCTATTGTCTGAGCAAGGTGTTAAGATTTGGGACGGTAATGGATCTCGTGAATATTTA
GATAAGATGGGGTTCAAAGATAGGAAAGTAGGAGATCTGGGGCCCGTTTACGGATTTCAA
TGGAGGCATTTTGGTGCTAAATACAAGACGTGCGATGACGACTATACTGGACAAGGTATT
GATCAATTGAAACAGGTTATACATAAACTAAAGACAAATCCCTACGATAGAAGAATCATT
ATGAGTGCCTGGAACCCAGCTGATTTTGACAAAATGGCTTTGCCGCCATGCCATATTTTT
TCACAGTTCTATGTCAGTTTCCCCAAAGAAGGAGAAGGATCCGGTAAGCCCCGCCTTTCA
TGCTTATTGTACCAACGTTCTTGTGATATGGGGTTGGGAGTACCATTTAACATTGCATCA
TATGCTTTGTTGACTAGAATGATTGCTAAAGTTGTCGACATGGAGCCAGGTGAGTTCATT
CATACTTTGGGGGATGCACATGTTTATAAAGACCACATTGATGCCTTGAAAGAACAAATC
ACCAGAAATCCAAGACCATTCCCGAAACTAAAGATTAAAAGGGACGTTAAAGACATTGAT
GATTTCAAGTTGACAGACTTTGAAATTGAAGATTATAATCCTCATCCAAGAATTCAAATG
AAAATGAGTGTATAA
Promoter Sequence
Download FASTA
>CDC21 YOR074C
CTTTGACTGAAATCTTTTCAGCGACAAATTATGCCTTTCCATTTCGTAATTCTCTAGGAA
TTCAAACTTTTTGAAATATTGTTGAATTTGCAGCCTGCATTCCATGTCAAACTCGTCCTT
TTCCGCATCACTCATATTAAAGTCATCTAAATAGTTTTTTTCAATCTGTTTTATTACCTT
GTTTAATTCGACTAGGAACTTCAATAGTCTTGCACATTCCTTAATAAACGAATCCCTAAA
CATTTCACACGTTTCATTAGAATTCCCGAAGTCCTCTTGTTTCCTTTCAACATGATCATC
TATACCATTTTGCTCATTTCTAGCATCATCGATAACAGCAACATACTTACGGAATATTGG
TGTTAAATCAGACATCATGAGTTAATAAGCTCTTCACTGCTTTTACGGGTGATTTCCCAG
CACCGGGGGAAATGATACTAGACGTATGTGTATGTATTCTAGTTATTCTCATTCATCTGA
GCTCACAAGTTGGGTAGGGTAACGGAGATCTTTCCTTGTTGGCAGTTCTTAATTAAATGT
GCCCTTTTCAGAAAGATACCAGCAAAGGTAGGAATGATTTATCATTACATGACATGTATC
CATATTCCAGGATGGATCATGCGAACAAGCTTCTTTCCCCTCTCGTCTGTAAAGGACGGG
ATTGAGATTCAATTAAAAAATTAGTTTCATTGGAAAAGGCCAATAAAATATGCAAAGGTC
CCGTCATTATACTGCAGCTACCTCAAAGAGATTAGCTTTGTGTCCTCAACGTAGGACCGC
ATTGAACAGGTTGGAAGAGGTGTTGCTTTTTTGACCTTCTTTCTCAAACTTAATATTTGG
TGACGCGTTAAATAGAAAAAATGAAAAAGACCTTAATTGACGCGTTTCCTGAAATATTTA
CTATAGCATAGCTGTAATTGTATTTTCTAAACTTGTAAGTGACTGTGTATATCAAACAAT
AAAGTATCAAGGAGAGAGCTTCATAACAGAACGGTACAGG
Chr coordinates Chr XV from 467589-466675
w3c xhtml validator w3c css validator