Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UFE1
Systematic Name YOR075W
Alias YOR29-26
Strain S288c
Description t-SNARE required for retrograde vesicular traffic and homotypic ER membrane fusion; forms a complex with the SNAREs Sec22p, Sec20p and Use1p to mediate fusion of Golgi-derived vesicles at the ER
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UFE1 YOR075W
AGCACCAAAATGCCTCCATTGAAATCCGTAAACGGGCCCCAGATCTCCTACTTTCCTATC
TTTGAACCCCATCTTATCTAAATATTCACGAGATCCATTACCGTCCCAAATCTTAACACC
TTGCTCAGACAATAGGTTAGCGTCTGTATCACCGGCCAAAAACCACAATAGTTCAAGTAT
GATACCTCTAGTAAAAACCTTCTTGGTCGTTAGTAGTGGGAAGGTATCATCACGTAAACT
AAAACGCAGCTGGGGTGGTGCAAAAAGACTCAACGTACCAGTGCCTGTTCTATCTGGCCT
AAATTCACCTTCATCAATGATTCTTTTGCATAGATCAAGATATTGCTCTTCTTCTTTGTT
TTTTCCGTCCATAGTCATCCTGTACCGTTCTGTTATGAAGCTCTCTCCTTGATACTTTAT
TGTTTGATATACACAGTCACTTACAAGTTTAGAAAATACAATTACAGCTATGCTATAGTA
AATATTTCAGGAAACGCGTCAATTAAGGTCTTTTTCATTTTTTCTATTTAACGCGTCACC
AAATATTAAGTTTGAGAAAGAAGGTCAAAAAAGCAACACCTCTTCCAACCTGTTCAATGC
GGTCCTACGTTGAGGACACAAAGCTAATCTCTTTGAGGTAGCTGCAGTATAATGACGGGA
CCTTTGCATATTTTATTGGCCTTTTCCAATGAAACTAATTTTTTAATTGAATCTCAATCC
CGTCCTTTACAGACGAGAGGGGAAAGAAGCTTGTTCGCATGATCCATCCTGGAATATGGA
TACATGTCATGTAATGATAAATCATTCCTACCTTTGCTGGTATCTTTCTGAAAAGGGCAC
ATTTAATTAAGAACTGCCAACAAGGAAAGATCTCCGTTACCCTACCCAACTTGTGAGCTC
AGATGAATGAGAATAACTAGAATACATACACATACGTCTAGTATCATTTCCCCCGGTGCT
GGGAAATCACCCGTAAAAGCAGTGAAGAGCTTATTAACTC
Chr coordinates Chr XV from 468212-469252
w3c xhtml validator w3c css validator