Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RTS2
Systematic Name YOR077W
Alias YOR29-28
Strain S288c
Description Basic zinc-finger protein, similar to human and mouse Kin17 proteins which are chromatin-associated proteins involved in UV response and DNA replication
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RTS2 YOR077W
TTTTCGGCCTTGGGCACAGATTTGATATTTAAGTTTTCTAATTTTTCATTGAAAGCATTA
AGTTGGGCCGATTGTATTATATCATCAGGACTTGGTCTATTGAAATTCTCAATGGCTACT
TTACGAGTTGTTTTCGGCAGGTTACAAGGCACAAAAATACCAAGGAGCTCATTGTTATGC
TTTTTTAAGGACAGAAATGATGAATTCTGCGACGATAGCGGTATTGATGTACTCAACGAG
TTTTTTTTATCTTTTATGATAAAGTTTGTGAACGCAAAATCGTCGGTTTGATTTATGCAT
GGATCGTTTTTCAAGAAACAGTAATGGTTCATTTCTTTAATAGCCTTCCATGACTCTTCT
AAGTTGAGTTTATCATCAGGCGATTTCCTTTTGGTAGGGAGTTCGTTTTCTTTGCTGTCT
AATGTCACTGATTTTCCTTGTTTCTCCAAATCACTATTTGACTTCTTTAAGGCAGACAAC
TTTAAACTCAATGAAACACTATGCTGGTTCGGGGTAAAGTCGCTTCTTTTTACCTTGTCT
TTTGCAAGTAGCGTCTTCAGATCCTTCCTTTTTGTCTCAGCATTGTTATCTTTAGTTTCT
CTATTCTTATGTAGTCTTTCTAGTAAGGATGCACTTTTCGATGTACTATGAGACTGGTCC
GCACTTAAAAGGCCTTTAGATTTTTCTATTCTTTTTCTTGCTAATTGCTCTAATAACGAC
ATGTCAGGTGGTACTGTAAGTTTCGAAGACCACCTCCTCGTACGTGTATTGTAGAAGGGT
CTCTAGGTTTATACCTCCAATCTGTTATAGTACATATTATAGTACACCAATGTAAATCTG
GTCCGGGTTACACAACACTTTGTCCTGTACTTTGAAAACTGGAAAAACTCCGCTAGTTGA
AATTAATATCAAATGGAAAAGTCAGTATCATCATTCTTTTCTTGACAAGTCCTAAAAAGA
GCGAAAACACAGGGTTGTTTGATTGTAGAAAATCACAGCG
Chr coordinates Chr XV from 471899-472597
w3c xhtml validator w3c css validator