Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OST3
Systematic Name YOR085W
Strain S288c
Description Gamma subunit of the oligosaccharyltransferase complex of the ER lumen, which catalyzes asparagine-linked glycosylation of newly synthesized proteins; Ost3p is important for N-glycosylation of a subset of proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OST3 YOR085W
CCAGGCTCTTGCGTGTGACGTCCTGCAGCCCAATCTGTTTCATTTGCTCATCTTGATCGA
GCCTGTAGTAATCACACGGAAAGCCATCGGCGCCGGGAGGCCAGGGCTTCCGCCCGATTC
TCCGCAGATCCCAGAAAATCTTTATAACTCCCTACGTTTAAAGACGTGCGACCATTTCGC
TAACGAGTCCGAATATGTAAAATATATGAGGAACGGTTCCTTTTTTACCAATGCGCACAG
CCAAATCCTGCAAAACATCATCGATTTTGAGAGGACAAAAGCCTCTGGAGACGATGAAGA
TGGTGGACCCGTTCGCACGAAGATGGAGCAGGCTCAAAATCTCCTCTGCTACATGAACAT
GCAGACTTTTGCGCCTTTCCTGATCAGCAATGTGAAGTTTGTGAGGAAGCGGACTATCCA
CATTGTGGGCGCGCGCTCCAACTGGTGTCCTCCGCAAAATCAGCTGTTTTTGCAGAAAAC
TCTACAGAACTACCATCTCGATGTCATTCCCGGCGGCTCCCACTTGGTCAACGTTGAGGC
TCCGGACCTGGTGATCGAGAGGATTAATCACCACATCCACGAGTTTGTCCTTACCTCCCC
GCTGCAGTCCTCACACATTCCGCAATTGACCCTTGAAGAAAGAGCGGTGATGTTTGACCG
GGCTTTCGACTCGTTCAAGAATGAAGCTTTGGTTAAAACGACTAAACAAAAACTGTAAAC
ACTTGTGTACACTATTACATATATTATTCAATAATAATTAACTGACGCAATCTATGGCAC
TGGCGTGGTTTCTTTTTCTTTTGTTTTCCGTGCAAGCGCGATGCAACTATATCGTCGAGG
ACGAATGTGTACCCGTCTTTCCGCCAGACAGGTAACAAGTACTTCAATTGACTTAGAAGA
AAAACATTAAGGAACTTTAACGTAGGAGCAACACAATACCAGGCACACGCTCTTCGAACA
CTGAACCACACGCGTCCGCATCAAACTCTTCCTCCCAAAC
Chr coordinates Chr XV from 482033-483085
w3c xhtml validator w3c css validator