Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CMR2
Systematic Name YOR093C
Strain S288c
Description Putative protein of unknown function; deletion causes sensitivity to unfolded protein response-inducing agents
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CMR2 YOR093C
GATACTGTTTTTTTTCCAGAAGTTTTCTTTTTAGTAAAGTACAATCCAGTAAAAATGAAG
GATGAACAATCGGTGTATGCAGATTCAACACCAATAAATGCAATGTTTATTTCTTTGGAA
CGTTTGTGTTGTTCGAAATCCAGGATAATCCTTCAACAAGACCCTGTCCGGATAAGGCGT
TACTACCGATGACACACCAAGGTTGGTTTTTCAAATTTTTCTCCAGTTCTAAAAAATCGG
AAACCTCTTGAGGTTTCATTGCATCTTTCAAATCTTGTTTGTTTGCCCATACCAGCAGTA
CTACATTCTCCATCTCTTTCTCACCTATGATACTATATAACTCTTCTTTGGCCTCTTCCA
TACGGTTTCTAGCACTAGAATCTATCACAAAGATAAGTGCGGTGGTGGCTGGAAAATAAT
GTCTCCAGAGAGGTCTCAATCTTTGTTGTCCTCCTACATCCCACATGTTGAATTTTACGT
TTTTATAAGTAACGGTTTCCACGTTAAAACCGACAGTGGGAGTAGACGTCTTTATTTTAT
TTAATTTTAGTTTGTACAATATTGTTGTCTTACCAGCCTTATCCAGGCCTAGCATCAAAA
TTTTCATTTCTTTCGAGCCAAATAGTTTTCCCAGAACCTTCGAAATTGAATTGCCCATCT
CTACAATTAGCTTGTCTTTTCCTTTTTTCCGTTCTAAATCCCAATTATCTTCCCAATGTC
AAAGCAACTGTAATGTCTCAGTCTAATTCAGCGTACGTTGCGTCTTACTATGCTTCTGCA
AATAGGGTTTTAATGCTGCGTACATCTTCATTATCTTATAAGTGCCATCATTCGGACGGG
TAATGGATGAAATCGTCAAAACCCGATTACTTTCTAGTATGTTTTATTTCTGTTTATAAT
GTAGTCAAAAGAGCTTCAACAGATTTAACATTTGCTTCCGTAAACTTGGTGTTAGGGTGA
TTCAGTTCTGTGTAAAAGCGTGTGGCATTGAGTTACTCCA
Chr coordinates Chr XV from 502452-497506
w3c xhtml validator w3c css validator