Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARF3
Systematic Name YOR094W
Alias ARL2
Strain S288c
Description Glucose-repressible ADP-ribosylation factor, GTPase of the Ras superfamily involved in development of polarity; also has mRNA binding activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARF3 YOR094W
AAATCTTATCCATTTTGTAAAGGTGACTCTTATTCAATTCATGTGCTACCCTCTCCGCTT
TCAAATAAAGTTTATCCCATGTGATGAACGTTTCTTTGCCTTTAGAATTTATGCTGATCA
TCGCTGTTTGACCATCATAATGTTCAAAGCGTCCCCGTAAAATTAGCGGTAAAGAATCCG
TCATTGCTGAGTCTCCACTGCTAGTATTTTCGGCTCCAGTGTGTCTTGGTAGTAATGGTA
TCATAGGATTATAAACGGCATCCTTCACTGAACCGTTTTCATCACTGGAACCTGGCAATG
ACGATTGCAAAGAAGCTGTATATCTCTTGCTCCGCCTTCTGGGAGTATTGTTCGCAGAAG
TCGAGTTTATAGTTGTGACACGATAGATAGAATGACGTCTGTCAATTGAATTAGGTAACG
ACGTAATGGATGATGCAAGACTTGTATTTCTTCTGTGCAAATGTTTCGACTTTCTCGAAT
TGGGAGATCGAAGCGGGGTATAAGGCCTCATTTGGGAGATTTCAAATTTGTCTAGCAATT
GTTTTCTTTTGGTCTCATAACCCTTTCTTGTTAGATTTTCATCCTTATAGTCTTGAATTA
ACTCATTTAACCGACTTTGCAGATCTAGAGGTAAGGTAGGAGGAATAGAAAAATCCATTG
GAGTAACTCAATGCCACACGCTTTTACACAGAACTGAATCACCCTAACACCAAGTTTACG
GAAGCAAATGTTAAATCTGTTGAAGCTCTTTTGACTACATTATAAACAGAAATAAAACAT
ACTAGAAAGTAATCGGGTTTTGACGATTTCATCCATTACCCGTCCGAATGATGGCACTTA
TAAGATAATGAAGATGTACGCAGCATTAAAACCCTATTTGCAGAAGCATAGTAAGACGCA
ACGTACGCTGAATTAGACTGAGACATTACAGTTGCTTTGACATTGGGAAGATAATTGGGA
TTTAGAACGGAAAAAAGGAAAAGACAAGCTAATTGTAGAG
Chr coordinates Chr XV from 502795-503346
w3c xhtml validator w3c css validator